Strain Name:
C57BL/6J-MtgxR7681Btlr/Mmmh
Stock Number:
045747-MU
Citation ID:
RRID:MMRRC_045747-MU
Other Names:
R7681 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Map2k6
Name: mitogen-activated protein kinase kinase 6
Synonyms: MAP kinase kinase 6, SAPKK3, Prkmk6, MKK6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26399
HGNC: HGNC:6846
Homologene: 55686
Rilpl1
Name: Rab interacting lysosomal protein-like 1
Synonyms: 2900002H16Rik, GOSPEL, 6330559I19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75695
Homologene: 15619
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Rtel1
Name: regulator of telomere elongation helicase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269400
Homologene: 13168
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Fgfr-1, Fr1, Hspy, FGFR-I, Eask, Flt-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: D17Rp17, D17Rp17e, MAPKKK4, Mekk4, MTK1, Tas, RP17, T-associated sex reversal
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain IIB, SMemb, NMHC-B, nonmuscle myosin heavy chain II-B, Myhn-2, 5730504C04Rik, myosin IIB, Fltn, Myhn2, Fltn, NMHC II-B, Myosin IIB, 9330167F11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Washc2
Name: WASH complex subunit 2
Synonyms: Fam21, D6Wsu116e, C530005J20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Anapc5
Name: anaphase-promoting complex subunit 5
Synonyms: 2510006G12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59008
Homologene: 41118
Akap13
Name: A kinase anchor protein 13
Synonyms: 5730522G15Rik, 1700026G02Rik, PROTO-LB, Ht31, PROTO-LBC, 5830460E08Rik, AKAP-Lbc
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Smg6
Name: SMG6 nonsense mediated mRNA decay factor
Synonyms: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103677
Homologene: 23024
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Slc43a2
Name: solute carrier family 43, member 2
Synonyms: 7630402D21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215113
Homologene: 17555
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: NMHC II-C, 2400004E04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71960
Homologene: 23480
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14696
Homologene: 69140
Muc20
Name: mucin 20
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224116
Homologene: 17135
Nup88
Name: nucleoporin 88
Synonyms: Prei2, Nup84
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19069
HGNC: HGNC:8067
Homologene: 1901
Limk2
Name: LIM domain kinase 2
Synonyms: A930024P04Rik, whe, LIM kinase 2, Limk2b, Limk2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16886
HGNC: HGNC:6614
Homologene: 55911
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Pak4
Name: p21 (RAC1) activated kinase 4
Synonyms: 5730488L07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70584
Homologene: 4300
Cyp20a1
Name: cytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms: A930011N14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77951
Homologene: 18584
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Zfp870
Name: zinc finger protein 870
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240066
VEGA: 17
Homologene: 48189
Hpse
Name: heparanase
Synonyms: Hpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15442
HGNC: HGNC:5164
Homologene: 68528
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 9530009M10Rik, 1810037O03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Ccp4, EG244071, Nna1-l1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, Dnahcl1, Dnahc17, 2810003K23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Glp2r
Name: glucagon-like peptide 2 receptor
Synonyms: GLP-2, 9530092J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93896
HGNC: HGNC:4325
Homologene: 3132
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: Fip200, 2900055E04Rik, 5930404L04Rik, Cc1, LaXp180
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Kif1a
Name: kinesin family member 1A
Synonyms: ATSV, N-3 kinesin, Kns1, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5, mH1, SkM2, Nav1.5c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Galnt16
Name: polypeptide N-acetylgalactosaminyltransferase 16
Synonyms: Galntl1, 5730405L21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108760
VEGA: 12
Homologene: 18907
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: mdr, Mdr1b, Mdr1, Pgy-1, Abcb1, Pgy1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: MX, 4931438M07Rik, alpha mannosidase IIx, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Fbxo41
Name: F-box protein 41
Synonyms: D6Ertd538e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330369
Homologene: 19837
Or4c116
Name: olfactory receptor family 4 subfamily C member 116
Synonyms: MOR233-3, GA_x6K02T2Q125-50591144-50590209, Olfr1221
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258904
Homologene: 73987
Ccs
Name: copper chaperone for superoxide dismutase
Synonyms: Ccsd, CCS
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12460
VEGA: 19
HGNC: HGNC:1613
Homologene: 3762
Or13p8
Name: olfactory receptor family 13 subfamily P member 8
Synonyms: GA_x6K02T2QD9B-18823451-18822504, MOR258-6, Olfr1340
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258301
Homologene: 122779
Dmwd
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: 59, DMR-N9, Dm9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13401
HGNC: HGNC:2936
Homologene: 22559
Morn5
Name: MORN repeat containing 5
Synonyms: 1700010A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75495
Homologene: 16510
Ssrp1
Name: structure specific recognition protein 1
Synonyms: Hmgox, Hmgi-rs3, Hmg1-rs1, T160
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20833
Homologene: 110735
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glurbeta2, Glur-6, C130030K03Rik, Glur6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Spata31e4
Name: spermatogenesis associated 31 subfamily E member 4
Synonyms: Gm8765
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 667693
Homologene: 134512
Sult1b1
Name: sulfotransferase family 1B, member 1
Synonyms: Dopa/tyrosine sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56362
Homologene: 69169
Hnf1b
Name: HNF1 homeobox B
Synonyms: Hnf1beta, Tcf-2, LFB3, HNF-1Beta, hepatocyte nuclear factor-1 beta, Tcf2, vHNF1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21410
Homologene: 396
Or5p56
Name: olfactory receptor family 5 subfamily P member 56
Synonyms: GA_x6K02T2PBJ9-10319672-10320604, Olfr477, MOR204-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258928
Homologene: 27246
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, mOat1, Oat1, Orctl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Golim4
Name: golgi integral membrane protein 4
Synonyms: P138, 3110027H23Rik, Golph4, GPP130
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73124
Homologene: 8716
Hoxa11
Name: homeobox A11
Synonyms: Hox-1.9, Hoxa-11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15396
HGNC: HGNC:5101
Homologene: 4033
Tfec
Name: transcription factor EC
Synonyms: TFEC, Tcfec, bHLHe34
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21426
Homologene: 32148
Psmc2
Name: proteasome (prosome, macropain) 26S subunit, ATPase 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19181
HGNC: HGNC:9548
Homologene: 2096
Defa25
Name: defensin, alpha, 25
Synonyms: Defcr25
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13236
Homologene: 113382
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13364, Gm13318, Diet1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Slc6a16
Name: solute carrier family 6, member 16
Synonyms: LOC381884
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381884
Homologene: 49366
Pabpn1
Name: poly(A) binding protein, nuclear 1
Synonyms: Pabp3, poly(A) binding protein II
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54196
HGNC: HGNC:8565
Homologene: 3412
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,240,323 bp
  • A to T, chromosome 1 at 24,067,915 bp
  • A to G, chromosome 1 at 60,353,033 bp
  • A to T, chromosome 1 at 93,054,944 bp
  • A to C, chromosome 1 at 134,865,935 bp
  • A to G, chromosome 2 at 16,218,102 bp
  • A to T, chromosome 2 at 36,057,144 bp
  • A to T, chromosome 2 at 40,874,999 bp
  • C to T, chromosome 2 at 76,708,951 bp
  • G to A, chromosome 2 at 85,045,748 bp
  • A to C, chromosome 2 at 89,111,591 bp
  • A to T, chromosome 2 at 142,756,126 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 2 at 181,322,394 bp
  • C to A, chromosome 3 at 32,587,753 bp
  • T to C, chromosome 3 at 75,887,024 bp
  • T to C, chromosome 3 at 83,049,832 bp
  • A to G, chromosome 4 at 118,726,564 bp
  • C to T, chromosome 5 at 8,849,619 bp
  • T to C, chromosome 5 at 21,803,274 bp
  • G to A, chromosome 5 at 87,530,636 bp
  • A to G, chromosome 5 at 100,691,391 bp
  • A to T, chromosome 5 at 122,802,139 bp
  • A to G, chromosome 5 at 124,530,913 bp
  • T to A, chromosome 6 at 16,834,236 bp
  • C to T, chromosome 6 at 52,245,119 bp
  • A to T, chromosome 6 at 85,478,479 bp
  • G to A, chromosome 6 at 88,467,653 bp
  • A to G, chromosome 6 at 116,260,657 bp
  • T to A, chromosome 7 at 19,081,082 bp
  • T to C, chromosome 7 at 28,560,230 bp
  • C to A, chromosome 7 at 44,624,148 bp
  • T to A, chromosome 7 at 45,260,914 bp
  • T to C, chromosome 7 at 75,728,796 bp
  • T to C, chromosome 7 at 76,444,901 bp
  • T to A, chromosome 7 at 80,351,749 bp
  • T to C, chromosome 7 at 107,991,148 bp
  • T to A, chromosome 8 at 21,084,519 bp
  • C to T, chromosome 8 at 25,555,661 bp
  • A to G, chromosome 9 at 119,529,977 bp
  • G to T, chromosome 10 at 49,244,380 bp
  • A to G, chromosome 11 at 3,353,354 bp
  • A to G, chromosome 11 at 30,791,975 bp
  • C to T, chromosome 11 at 67,709,679 bp
  • C to T, chromosome 11 at 68,771,936 bp
  • C to A, chromosome 11 at 70,969,885 bp
  • T to A, chromosome 11 at 74,931,705 bp
  • T to A, chromosome 11 at 75,563,673 bp
  • T to G, chromosome 11 at 83,889,146 bp
  • C to T, chromosome 11 at 110,497,903 bp
  • C to T, chromosome 11 at 118,025,186 bp
  • A to T, chromosome 12 at 80,590,639 bp
  • A to G, chromosome 13 at 38,346,195 bp
  • C to T, chromosome 13 at 50,702,254 bp
  • T to C, chromosome 14 at 54,898,042 bp
  • C to A, chromosome 16 at 15,895,624 bp
  • T to C, chromosome 16 at 32,793,619 bp
  • C to A, chromosome 16 at 52,204,638 bp
  • G to A, chromosome 17 at 12,318,543 bp
  • T to C, chromosome 17 at 32,882,690 bp
  • T to A, chromosome 18 at 24,990,038 bp
  • T to A, chromosome 19 at 4,832,830 bp
  • G to A, chromosome 19 at 8,626,129 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7681 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045747-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.