Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7681Btlr/Mmmh
Stock Number:
045747-MU
Citation ID:
RRID:MMRRC_045747-MU
Other Names:
R7681 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Map2k6
Name: mitogen-activated protein kinase kinase 6
Synonyms: MAP kinase kinase 6, MKK6, SAPKK3, Prkmk6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26399
HGNC: HGNC:6846
Homologene: 55686
Rilpl1
Name: Rab interacting lysosomal protein-like 1
Synonyms: 6330559I19Rik, 2900002H16Rik, GOSPEL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75695
Homologene: 15619
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Flt-2, Fgfr-1, Hspy, Eask, FGFR-I, Fr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,240,323 bp
  • A to T, chromosome 1 at 24,067,915 bp
  • A to G, chromosome 1 at 60,353,033 bp
  • A to T, chromosome 1 at 93,054,944 bp
  • A to C, chromosome 1 at 134,865,935 bp
  • A to G, chromosome 2 at 16,218,102 bp
  • A to T, chromosome 2 at 36,057,144 bp
  • A to T, chromosome 2 at 40,874,999 bp
  • C to T, chromosome 2 at 76,708,951 bp
  • G to A, chromosome 2 at 85,045,748 bp
  • A to C, chromosome 2 at 89,111,591 bp
  • A to T, chromosome 2 at 142,756,126 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 2 at 181,322,394 bp
  • C to A, chromosome 3 at 32,587,753 bp
  • T to C, chromosome 3 at 75,887,024 bp
  • T to C, chromosome 3 at 83,049,832 bp
  • A to G, chromosome 4 at 118,726,564 bp
  • C to T, chromosome 5 at 8,849,619 bp
  • T to C, chromosome 5 at 21,803,274 bp
  • G to A, chromosome 5 at 87,530,636 bp
  • A to G, chromosome 5 at 100,691,391 bp
  • A to T, chromosome 5 at 122,802,139 bp
  • A to G, chromosome 5 at 124,530,913 bp
  • T to A, chromosome 6 at 16,834,236 bp
  • C to T, chromosome 6 at 52,245,119 bp
  • A to T, chromosome 6 at 85,478,479 bp
  • G to A, chromosome 6 at 88,467,653 bp
  • A to G, chromosome 6 at 116,260,657 bp
  • T to A, chromosome 7 at 19,081,082 bp
  • T to C, chromosome 7 at 28,560,230 bp
  • C to A, chromosome 7 at 44,624,148 bp
  • T to A, chromosome 7 at 45,260,914 bp
  • T to C, chromosome 7 at 75,728,796 bp
  • T to C, chromosome 7 at 76,444,901 bp
  • T to A, chromosome 7 at 80,351,749 bp
  • T to C, chromosome 7 at 107,991,148 bp
  • T to A, chromosome 8 at 21,084,519 bp
  • C to T, chromosome 8 at 25,555,661 bp
  • A to G, chromosome 9 at 119,529,977 bp
  • G to T, chromosome 10 at 49,244,380 bp
  • A to G, chromosome 11 at 3,353,354 bp
  • A to G, chromosome 11 at 30,791,975 bp
  • C to T, chromosome 11 at 67,709,679 bp
  • C to T, chromosome 11 at 68,771,936 bp
  • C to A, chromosome 11 at 70,969,885 bp
  • T to A, chromosome 11 at 74,931,705 bp
  • T to A, chromosome 11 at 75,563,673 bp
  • T to G, chromosome 11 at 83,889,146 bp
  • C to T, chromosome 11 at 110,497,903 bp
  • C to T, chromosome 11 at 118,025,186 bp
  • A to T, chromosome 12 at 80,590,639 bp
  • A to G, chromosome 13 at 38,346,195 bp
  • C to T, chromosome 13 at 50,702,254 bp
  • T to C, chromosome 14 at 54,898,042 bp
  • C to A, chromosome 16 at 15,895,624 bp
  • T to C, chromosome 16 at 32,793,619 bp
  • C to A, chromosome 16 at 52,204,638 bp
  • G to A, chromosome 17 at 12,318,543 bp
  • T to C, chromosome 17 at 32,882,690 bp
  • T to A, chromosome 18 at 24,990,038 bp
  • T to A, chromosome 19 at 4,832,830 bp
  • G to A, chromosome 19 at 8,626,129 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7681 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045747-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.