Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8529Btlr/Mmmh
Stock Number:
068499-MU
Citation ID:
RRID:MMRRC_068499-MU
Other Names:
R8529 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Dgat1
Name: diacylglycerol O-acyltransferase 1
Synonyms: D15Ertd23e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13350
HGNC: HGNC:2843
Homologene: 7688
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Lyz2
Name: lysozyme 2
Synonyms: Lzp, Lzm, Lys, Lzm-s1, Lyzs, Lysm
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17105
VEGA: 10
HGNC: HGNC:6740
Homologene: 121490
Prdm5
Name: PR domain containing 5
Synonyms: 6530401I24Rik, E130112L17Rik, PFM2, 4432417F03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70779
HGNC: HGNC:9349
Homologene: 10274
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Ints13
Name: integrator complex subunit 13
Synonyms: 4933424B01Rik, Spata30, Asun
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71177
Homologene: 10043
Zp3
Name: zona pellucida glycoprotein 3
Synonyms: Zp-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22788
Homologene: 5178
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Ifnar2
Name: interferon (alpha and beta) receptor 2
Synonyms: Ifnar-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15976
HGNC: HGNC:5433
Homologene: 49242
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: Erbb-3, Erbb3r, HER3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Bcl2l11
Name: BCL2 like 11
Synonyms: Bod, Bim, 1500006F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12125
HGNC: HGNC:994
Homologene: 7643
Sec63
Name: SEC63 homolog, protein translocation regulator
Synonyms: 5730478J10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140740
Homologene: 5220
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Slc44a3
Name: solute carrier family 44, member 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213603
Homologene: 64830
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Reg3d
Name: regenerating islet-derived 3 delta
Synonyms: Ingaprp, INGAP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30053
Homologene: 137262
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Dhx36
Name: DEAH-box helicase 36
Synonyms: Ddx36, 2810407E23Rik, RHAU
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72162
Homologene: 6356
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Slc24a2
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms: 6330417K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76376
Homologene: 10669
Gnb3
Name: guanine nucleotide binding protein (G protein), beta 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14695
HGNC: HGNC:4400
Homologene: 55628
Tsbp1
Name: testis expressed basic protein 1
Synonyms: BC051142
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 407788
Homologene: 128168
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Or8a1
Name: olfactory receptor family 8 subfamily A member 1
Synonyms: M71, MOR171-2, GA_x6K02T2PVTD-31408136-31407207, Olfr151
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 406176
HGNC: HGNC:8469
Homologene: 12726
Or13p8
Name: olfactory receptor family 13 subfamily P member 8
Synonyms: GA_x6K02T2QD9B-18823451-18822504, MOR258-6, Olfr1340
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258301
Homologene: 122779
Tsen54
Name: tRNA splicing endonuclease subunit 54
Synonyms: 0610034P02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76265
Homologene: 35476
Serpinb9b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9b
Synonyms: 1600019A21Rik, Spi10, R86, ovalbumin, SPI-CI
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20706
HGNC: HGNC:8955
Homologene: 137240
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Fam149b
Name: family with sequence similarity 149, member B
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105428
VEGA: 14
Homologene: 67023
Foxc1
Name: forkhead box C1
Synonyms: frkhda, fkh1, fkh-1, FREAC3, Mf1, Fkh1, Mf4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17300
HGNC: HGNC:3800
Homologene: 20373
Prss3b
Name: serine protease 3B
Synonyms: 2210010C04Rik, T7, cationic trypsinogen (isoform T7)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67373
Homologene: 134055
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192194
Homologene: 138184
Or11i1
Name: olfactory receptor family 11 subfamily I member 1
Synonyms: GA_x6K02T2N6GK-529983-529033, MOR122-2, Olfr266
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 258482
Homologene: 51728
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Usp49
Name: ubiquitin specific peptidase 49
Synonyms: C330046L10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224836
Homologene: 10235
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Slc22a28
Name: solute carrier family 22, member 28
Synonyms: Gm5631
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 434674
VEGA: 19
Homologene: 77136
Il27
Name: interleukin 27
Synonyms: p28, IL-27, Il30, IL-27p28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246779
Homologene: 17087
Gm38394
Name: predicted gene, 38394
Type: Gene
Species: Mouse
Chromosome: 1
Tff3
Name: trefoil factor 3, intestinal
Synonyms: mITF, ITF
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21786
Homologene: 2427
Potefam3b
Name: POTE ankyrin domain family member 3B
Synonyms: Pote3b, Gm21119
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100861668
Homologene: 128726
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,184,432 bp
  • T to A, chromosome 1 at 43,983,140 bp
  • T to C, chromosome 1 at 133,656,968 bp
  • T to A, chromosome 1 at 162,709,094 bp
  • A to G, chromosome 2 at 23,080,692 bp
  • A to T, chromosome 2 at 69,500,642 bp
  • A to C, chromosome 2 at 120,773,857 bp
  • T to C, chromosome 2 at 128,128,876 bp
  • TCCGCCGCCGCCGCCGC to TCCGCCGCCGCCGC, chromosome 3 at 62,506,856 bp
  • A to T, chromosome 3 at 106,821,793 bp
  • G to T, chromosome 3 at 121,525,685 bp
  • T to C, chromosome 4 at 76,129,025 bp
  • T to C, chromosome 4 at 87,028,280 bp
  • A to T, chromosome 4 at 118,726,573 bp
  • A to T, chromosome 5 at 44,013,027 bp
  • T to C, chromosome 5 at 110,719,236 bp
  • C to A, chromosome 5 at 135,987,265 bp
  • T to A, chromosome 6 at 41,032,435 bp
  • C to T, chromosome 6 at 65,901,845 bp
  • C to G, chromosome 6 at 78,376,399 bp
  • A to T, chromosome 6 at 124,837,670 bp
  • G to A, chromosome 6 at 146,329,553 bp
  • T to C, chromosome 6 at 146,563,428 bp
  • T to A, chromosome 7 at 29,070,084 bp
  • A to G, chromosome 7 at 97,670,867 bp
  • A to T, chromosome 7 at 126,592,805 bp
  • A to G, chromosome 7 at 135,713,959 bp
  • A to G, chromosome 8 at 20,619,158 bp
  • G to A, chromosome 8 at 102,664,755 bp
  • A to G, chromosome 8 at 105,885,050 bp
  • A to T, chromosome 9 at 37,730,956 bp
  • A to G, chromosome 9 at 75,212,872 bp
  • G to A, chromosome 9 at 108,111,452 bp
  • A to G, chromosome 10 at 42,789,383 bp
  • A to T, chromosome 10 at 109,853,331 bp
  • A to T, chromosome 10 at 117,280,663 bp
  • A to G, chromosome 10 at 128,583,200 bp
  • A to T, chromosome 11 at 58,922,412 bp
  • C to T, chromosome 11 at 69,908,787 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • T to C, chromosome 11 at 103,457,547 bp
  • G to T, chromosome 11 at 115,820,560 bp
  • A to T, chromosome 12 at 8,007,353 bp
  • G to A, chromosome 12 at 87,960,086 bp
  • A to G, chromosome 13 at 31,808,537 bp
  • A to T, chromosome 13 at 33,039,560 bp
  • A to T, chromosome 13 at 112,344,136 bp
  • T to A, chromosome 14 at 20,358,302 bp
  • T to C, chromosome 15 at 76,427,632 bp
  • T to A, chromosome 15 at 76,503,037 bp
  • C to A, chromosome 16 at 59,556,621 bp
  • T to A, chromosome 16 at 91,391,796 bp
  • A to G, chromosome 17 at 31,129,486 bp
  • G to T, chromosome 17 at 34,460,169 bp
  • A to T, chromosome 17 at 47,672,112 bp
  • G to A, chromosome 19 at 8,063,413 bp
  • T to A, chromosome 19 at 27,230,256 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8529 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068499-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.