Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8778Btlr/Mmmh
Stock Number:
068603-MU
Citation ID:
RRID:MMRRC_068603-MU
Other Names:
R8778 (G1)
Major Collection:

Strain Information

Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: PSGAP-s, PSGAP-m, A930033B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78514
Homologene: 12695
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Syncrip
Name: synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms: RRM RNA binding protein GRY-RBP, GRY-RBP, pp68, Nsap1l, Nsap1, 4632417O19Rik, 2610109K23Rik, hnRNP Q
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56403
Homologene: 4648
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CA to CAA, chromosome 1 at 65,165,188 bp
  • C to T, chromosome 1 at 167,375,463 bp
  • C to T, chromosome 2 at 4,473,215 bp
  • T to C, chromosome 2 at 17,404,267 bp
  • G to A, chromosome 2 at 25,081,846 bp
  • T to C, chromosome 2 at 76,761,236 bp
  • T to C, chromosome 3 at 36,670,921 bp
  • T to G, chromosome 3 at 83,766,786 bp
  • T to C, chromosome 3 at 123,006,507 bp
  • T to C, chromosome 4 at 33,095,517 bp
  • T to C, chromosome 4 at 85,514,450 bp
  • T to C, chromosome 4 at 144,392,896 bp
  • G to T, chromosome 5 at 86,112,697 bp
  • T to A, chromosome 5 at 138,646,887 bp
  • T to C, chromosome 5 at 145,218,332 bp
  • A to G, chromosome 6 at 135,168,070 bp
  • A to C, chromosome 7 at 73,429,735 bp
  • A to T, chromosome 7 at 86,164,289 bp
  • A to T, chromosome 7 at 104,411,565 bp
  • A to G, chromosome 7 at 118,623,593 bp
  • T to C, chromosome 8 at 23,245,928 bp
  • T to G, chromosome 8 at 70,617,592 bp
  • T to C, chromosome 8 at 77,413,611 bp
  • A to T, chromosome 9 at 88,456,241 bp
  • A to G, chromosome 9 at 108,405,608 bp
  • T to C, chromosome 10 at 5,359,066 bp
  • T to A, chromosome 10 at 22,067,457 bp
  • T to A, chromosome 10 at 100,514,512 bp
  • A to G, chromosome 10 at 127,357,824 bp
  • T to A, chromosome 11 at 64,436,425 bp
  • A to G, chromosome 11 at 77,823,324 bp
  • T to C, chromosome 11 at 98,983,016 bp
  • T to A, chromosome 12 at 98,658,556 bp
  • T to C, chromosome 12 at 100,945,224 bp
  • C to T, chromosome 12 at 112,658,668 bp
  • T to A, chromosome 12 at 112,783,158 bp
  • T to C, chromosome 13 at 13,635,776 bp
  • A to G, chromosome 13 at 13,728,567 bp
  • T to C, chromosome 13 at 62,605,355 bp
  • A to G, chromosome 14 at 26,734,563 bp
  • T to G, chromosome 14 at 101,912,067 bp
  • T to C, chromosome 14 at 101,919,219 bp
  • A to G, chromosome 14 at 103,055,482 bp
  • T to A, chromosome 14 at 123,840,663 bp
  • A to G, chromosome 15 at 12,269,920 bp
  • G to A, chromosome 15 at 64,127,409 bp
  • G to A, chromosome 16 at 20,673,446 bp
  • A to G, chromosome 16 at 56,035,009 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • G to T, chromosome 17 at 32,702,404 bp
  • T to C, chromosome 17 at 33,269,446 bp
  • G to T, chromosome 18 at 36,999,191 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8778 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068603-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.