Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8778Btlr/Mmmh
Stock Number:
068603-MU
Citation ID:
RRID:MMRRC_068603-MU
Other Names:
R8778 (G1)
Major Collection:

Strain Information

Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: PSGAP-s, PSGAP-m, A930033B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78514
Homologene: 12695
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Syncrip
Name: synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms: RRM RNA binding protein GRY-RBP, GRY-RBP, pp68, Nsap1l, Nsap1, 4632417O19Rik, 2610109K23Rik, hnRNP Q
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56403
Homologene: 4648
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Uba6
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231380
Homologene: 10080
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Eif4g1
Name: eukaryotic translation initiation factor 4, gamma 1
Synonyms: E030015G23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208643
HGNC: HGNC:3296
Homologene: 110725
Hs3st3a1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Synonyms: 3Ost3a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15478
HGNC: HGNC:5196
Homologene: 88735
Lmo7
Name: LIM domain only 7
Synonyms: LOC380928, FBXO20
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380928
HGNC: HGNC:6646
Homologene: 83924
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77739
Homologene: 64642
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Sfrp2
Name: secreted frizzled-related protein 2
Synonyms: Sdf5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20319
Homologene: 56438
Mgst3
Name: microsomal glutathione S-transferase 3
Synonyms: GST-III, 2010306B17Rik, 2010012L10Rik, 2700004G04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66447
HGNC: HGNC:7064
Homologene: 3327
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Trpc3
Name: transient receptor potential cation channel, subfamily C, member 3
Synonyms: Trp3, Trrp3, Trcp3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22065
Homologene: 20708
Inhbc
Name: inhibin beta-C
Synonyms: activin beta-C
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16325
VEGA: 10
HGNC: HGNC:6068
Homologene: 21142
Vmn2r75
Name: vomeronasal 2, receptor 75
Synonyms: EG546981
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546981
Homologene: 115466
Trim30a
Name: tripartite motif-containing 30A
Synonyms: Rpt-1, Rpt1, Trim30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20128
Homologene: 114426
Acod1
Name: aconitate decarboxylase 1
Synonyms: Irg1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16365
Homologene: 35405
Frmd4a
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209630
Homologene: 9971
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Tmc5
Name: transmembrane channel-like gene family 5
Synonyms: 4932443L08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74424
Homologene: 11713
Itgbl1
Name: integrin, beta-like 1
Synonyms: with EGF-like repeat domains, B930011D01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223272
HGNC: HGNC:6164
Homologene: 3519
Iho1
Name: interactor of HORMAD1 1
Synonyms: Ccdc36, Iho1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434438
Homologene: 52256
Or10h28
Name: olfactory receptor family 10 subfamily H member 28
Synonyms: M4, MOR267-1, GA_x6K02T2NTC5-9778-8828, Olfr63
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258939
Homologene: 130665
A430033K04Rik
Name: RIKEN cDNA A430033K04 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243308
Homologene: 65621
Spata7
Name: spermatogenesis associated 7
Synonyms: HSD3, B230306G18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104871
Homologene: 10189
Akt1
Name: thymoma viral proto-oncogene 1
Synonyms: PKB/Akt, PKBalpha, Akt, PKB
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11651
HGNC: HGNC:391
Homologene: 3785
Trmt10c
Name: tRNA methyltransferase 10C, mitochondrial RNase P subunit
Synonyms: 1300018J16Rik, D16Ertd454e, Rg9mtd1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52575
Homologene: 9858
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: Idh-1, Id-1, E030024J03Rik, IDPc
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Lrrc25
Name: leucine rich repeat containing 25
Synonyms: Mapa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211228
Homologene: 51663
Hebp1
Name: heme binding protein 1
Synonyms: p22 HBP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15199
Homologene: 8407
Zfp1008
Name: zinc finger protein 1008
Synonyms: 6720489N17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 211378
Entpd8
Name: ectonucleoside triphosphate diphosphohydrolase 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72090
Homologene: 77857
Semp2l2b
Name: SUMO/sentrin specific peptidase 2-like 2B
Synonyms: 4930444G20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114671
Homologene: 130042
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Myoz2
Name: myozenin 2
Synonyms: calsarcin-1, 1110012I24Rik, Fatz-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59006
HGNC: HGNC:1330
Homologene: 9583
Cyp4f15
Name: cytochrome P450, family 4, subfamily f, polypeptide 15
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106648
HGNC: HGNC:2645
Homologene: 80199
Gjd3
Name: gap junction protein, delta 3
Synonyms: Gja11, connexin-30.2, cx30.2, connexin 30.2, Gjc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353155
Homologene: 17530
Pcdha9
Name: protocadherin alpha 9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192161
HGNC: HGNC:8664
Homologene: 130700
Golga7
Name: golgin A7
Synonyms: GOLGA3AP1, HSPC041, GCP16, C130038N16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57437
Homologene: 9385
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CA to CAA, chromosome 1 at 65,165,188 bp
  • C to T, chromosome 1 at 167,375,463 bp
  • C to T, chromosome 2 at 4,473,215 bp
  • T to C, chromosome 2 at 17,404,267 bp
  • G to A, chromosome 2 at 25,081,846 bp
  • T to C, chromosome 2 at 76,761,236 bp
  • T to C, chromosome 3 at 36,670,921 bp
  • T to G, chromosome 3 at 83,766,786 bp
  • T to C, chromosome 3 at 123,006,507 bp
  • T to C, chromosome 4 at 33,095,517 bp
  • T to C, chromosome 4 at 85,514,450 bp
  • T to C, chromosome 4 at 144,392,896 bp
  • G to T, chromosome 5 at 86,112,697 bp
  • T to A, chromosome 5 at 138,646,887 bp
  • T to C, chromosome 5 at 145,218,332 bp
  • A to G, chromosome 6 at 135,168,070 bp
  • A to C, chromosome 7 at 73,429,735 bp
  • A to T, chromosome 7 at 86,164,289 bp
  • A to T, chromosome 7 at 104,411,565 bp
  • A to G, chromosome 7 at 118,623,593 bp
  • T to C, chromosome 8 at 23,245,928 bp
  • T to G, chromosome 8 at 70,617,592 bp
  • T to C, chromosome 8 at 77,413,611 bp
  • A to T, chromosome 9 at 88,456,241 bp
  • A to G, chromosome 9 at 108,405,608 bp
  • T to C, chromosome 10 at 5,359,066 bp
  • T to A, chromosome 10 at 22,067,457 bp
  • T to A, chromosome 10 at 100,514,512 bp
  • A to G, chromosome 10 at 127,357,824 bp
  • T to A, chromosome 11 at 64,436,425 bp
  • A to G, chromosome 11 at 77,823,324 bp
  • T to C, chromosome 11 at 98,983,016 bp
  • T to A, chromosome 12 at 98,658,556 bp
  • T to C, chromosome 12 at 100,945,224 bp
  • C to T, chromosome 12 at 112,658,668 bp
  • T to A, chromosome 12 at 112,783,158 bp
  • T to C, chromosome 13 at 13,635,776 bp
  • A to G, chromosome 13 at 13,728,567 bp
  • T to C, chromosome 13 at 62,605,355 bp
  • A to G, chromosome 14 at 26,734,563 bp
  • T to G, chromosome 14 at 101,912,067 bp
  • T to C, chromosome 14 at 101,919,219 bp
  • A to G, chromosome 14 at 103,055,482 bp
  • T to A, chromosome 14 at 123,840,663 bp
  • A to G, chromosome 15 at 12,269,920 bp
  • G to A, chromosome 15 at 64,127,409 bp
  • G to A, chromosome 16 at 20,673,446 bp
  • A to G, chromosome 16 at 56,035,009 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • G to T, chromosome 17 at 32,702,404 bp
  • T to C, chromosome 17 at 33,269,446 bp
  • G to T, chromosome 18 at 36,999,191 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8778 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068603-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.