Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8909Btlr/Mmmh
Stock Number:
068700-MU
Citation ID:
RRID:MMRRC_068700-MU
Other Names:
R8909 (G1)
Major Collection:

Strain Information

Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, D19Ertd703e, Pp6r3, Pptcs3, Saps3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Kat6b
Name: K(lysine) acetyltransferase 6B
Synonyms: qkf, querkopf, Morf, B130044K16Rik, monocytic leukemia, Myst4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54169
Homologene: 136480
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Os9
Name: amplified in osteosarcoma
Synonyms: 4632413K17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216440
VEGA: 10
Homologene: 31409
Psmb7
Name: proteasome (prosome, macropain) subunit, beta type 7
Synonyms: MC14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19177
HGNC: HGNC:9544
Homologene: 2093
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243621
Homologene: 46091
Rbm39
Name: RNA binding motif protein 39
Synonyms: caper, 2310040E03Rik, 1500012C14Rik, Rnpc2, B330012G18Rik, Caper alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170791
Homologene: 136465
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Prokr2
Name: prokineticin receptor 2
Synonyms: PKR2, B830005M06Rik, EG-VEGRF2, Gpr73l1, Gpcr73l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 246313
Homologene: 16368
Slc49a3
Name: solute carrier family 49 member 3
Synonyms: 4732482E20Rik, Mfsd7, Mfsd7a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243197
VEGA: 5
Homologene: 49990
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Plod1
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Synonyms: lysyl hydroxylase 1, LH1, 2410042F05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18822
HGNC: HGNC:9081
Homologene: 256
Samd12
Name: sterile alpha motif domain containing 12
Synonyms: A830094I09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320679
Homologene: 35979
Wasf3
Name: WASP family, member 3
Synonyms: Wave3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245880
Homologene: 68527
Sdc3
Name: syndecan 3
Synonyms: Synd3, syn-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20970
Homologene: 7965
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Dach1
Name: dachshund family transcription factor 1
Synonyms: Dac, E130112M23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13134
HGNC: HGNC:2663
Homologene: 7288
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
Or7g20
Name: olfactory receptor family 7 subfamily G member 20
Synonyms: GA_x6K02T2PVTD-12771995-12772930, MOR150-3, Olfr835
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257872
HGNC: HGNC:8466
Homologene: 133702
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Cryga
Name: crystallin, gamma A
Synonyms: DGcry-4, Cryg-4, Secc
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12964
HGNC: HGNC:2408
Homologene: 129704
Pard3b
Name: par-3 family cell polarity regulator beta
Synonyms: 2810455B10Rik, PAR3beta, PAR3L, PAR3B, 2010002N16Rik, Als2cr19, 1810008K04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72823
Homologene: 35389
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214593
Homologene: 9689
Clec2g
Name: C-type lectin domain family 2, member g
Synonyms: 4632413B12Rik, Ocilrp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70809
Homologene: 136309
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Serpina1a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1A
Synonyms: PI1, Aat-2, Spi1-1, Aat2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20700
HGNC: HGNC:8941
Homologene: 20103
Lingo2
Name: leucine rich repeat and Ig domain containing 2
Synonyms: B230217C06Rik, Lrrn6c, LERN3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242384
Homologene: 17621
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Or56a5
Name: olfactory receptor family 56 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-7773007-7772066, MOR40-1, Olfr683
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259047
Homologene: 133645
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Or8k27
Name: olfactory receptor family 8 subfamily K member 27
Synonyms: GA_x6K02T2Q125-47915274-47914333, MOR190-1, Olfr1065
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258403
Homologene: 74195
Foxg1
Name: forkhead box G1
Synonyms: BF-1, Hfh9, Hfhbf1, Bf1, 2900064B05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15228
HGNC: HGNC:3811
Homologene: 3843
V1ra8
Name: vomeronasal 1 receptor, A8
Synonyms: Vmn1r-ps33
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113850
Zbtb34
Name: zinc finger and BTB domain containing 34
Synonyms: LOC241311
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241311
Homologene: 19382
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192194
Homologene: 138184
Or51a43
Name: olfactory receptor family 51 subfamily A member 43
Synonyms: GA_x6K02T2PBJ9-6803062-6802118, MOR13-1, Olfr644
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259125
Homologene: 17491
Cntn6
Name: contactin 6
Synonyms: NB-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53870
HGNC: HGNC:2176
Homologene: 8702
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Cavin4
Name: caveolae associated 4
Synonyms: 2310039E09Rik, cavin 4, Murc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68016
Homologene: 12224
Llcfc1
Name: LLLL and CFNLAS motif containing 1
Synonyms: 1700034O15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76606
Homologene: 81932
Saa1
Name: serum amyloid A 1
Synonyms: Saa-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20208
Homologene: 128033
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 62,344,135 bp
  • G to T, chromosome 1 at 65,103,014 bp
  • A to G, chromosome 1 at 140,086,348 bp
  • A to C, chromosome 2 at 33,411,689 bp
  • A to G, chromosome 2 at 38,613,469 bp
  • T to C, chromosome 2 at 49,279,221 bp
  • A to G, chromosome 2 at 59,354,414 bp
  • G to A, chromosome 2 at 70,253,096 bp
  • C to T, chromosome 2 at 86,445,738 bp
  • A to C, chromosome 2 at 121,298,910 bp
  • A to G, chromosome 2 at 122,296,381 bp
  • T to C, chromosome 2 at 132,373,803 bp
  • C to T, chromosome 2 at 156,177,777 bp
  • A to T, chromosome 4 at 15,970,833 bp
  • A to G, chromosome 4 at 35,708,349 bp
  • G to A, chromosome 4 at 48,672,421 bp
  • T to G, chromosome 4 at 103,087,410 bp
  • A to G, chromosome 4 at 130,818,783 bp
  • T to C, chromosome 4 at 144,376,983 bp
  • T to A, chromosome 4 at 147,927,106 bp
  • C to T, chromosome 5 at 108,444,566 bp
  • C to A, chromosome 5 at 142,776,376 bp
  • T to C, chromosome 5 at 146,455,600 bp
  • T to TCCG, chromosome 6 at 4,756,451 bp
  • T to C, chromosome 6 at 41,684,591 bp
  • T to C, chromosome 6 at 90,202,956 bp
  • T to A, chromosome 6 at 104,848,132 bp
  • G to A, chromosome 6 at 121,413,159 bp
  • A to G, chromosome 6 at 128,981,232 bp
  • T to A, chromosome 7 at 16,185,460 bp
  • T to C, chromosome 7 at 46,741,349 bp
  • A to G, chromosome 7 at 104,068,825 bp
  • C to T, chromosome 7 at 105,144,042 bp
  • T to C, chromosome 7 at 127,879,343 bp
  • A to T, chromosome 8 at 55,991,124 bp
  • G to T, chromosome 9 at 19,035,592 bp
  • C to A, chromosome 10 at 127,120,956 bp
  • T to C, chromosome 11 at 58,922,372 bp
  • C to T, chromosome 11 at 61,799,554 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • A to G, chromosome 11 at 107,666,008 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 12 at 49,384,692 bp
  • T to C, chromosome 12 at 103,854,679 bp
  • G to T, chromosome 13 at 63,240,297 bp
  • A to G, chromosome 14 at 21,669,146 bp
  • C to T, chromosome 14 at 52,212,932 bp
  • T to C, chromosome 14 at 98,168,684 bp
  • T to C, chromosome 15 at 16,848,524 bp
  • A to G, chromosome 15 at 53,658,457 bp
  • T to A, chromosome 17 at 67,772,741 bp
  • T to A, chromosome 18 at 58,059,436 bp
  • T to C, chromosome 19 at 3,459,461 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8909 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068700-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.