Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9231Btlr/Mmmh
Stock Number:
068985-MU
Citation ID:
RRID:MMRRC_068985-MU
Other Names:
R9231 (G1)
Major Collection:

Strain Information

Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Galr2
Name: galanin receptor 2
Synonyms: mGalR, GalR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14428
HGNC: HGNC:4133
Homologene: 2863
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Fam169a
Name: family with sequence similarity 169, member A
Synonyms: B230112C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320557
VEGA: 13
Homologene: 52656
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Mif
Name: macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Synonyms: Glif
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17319
VEGA: 10
HGNC: HGNC:7097
Homologene: 55655
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27103
Homologene: 40891
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Ankrd28
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105522
VEGA: 14
Homologene: 35374
Tbc1d10a
Name: TBC1 domain family, member 10a
Synonyms: EPI64, Tbc1d10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103724
Homologene: 32762
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Gucy1a1
Name: guanylate cyclase 1, soluble, alpha 1
Synonyms: alpha 1 sGC, 1200016O07Rik, sGC-alpha1, Gucy1a3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 60596
HGNC: HGNC:4685
Homologene: 37360
Emp1
Name: epithelial membrane protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13730
HGNC: HGNC:3333
Homologene: 1088
Pcbp2
Name: poly(rC) binding protein 2
Synonyms: alphaCP-2, Hnrpx
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18521
VEGA: 15
HGNC: HGNC:8648
Homologene: 74536
Tcp1
Name: t-complex protein 1
Synonyms: Ccta, c-cpn, TRic, CCT, Tcp-1, Tp63, p63, Cct1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21454
Homologene: 5656
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Akirin2
Name: akirin 2
Synonyms: 2700059D21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433693
Homologene: 9988
Ing5
Name: inhibitor of growth family, member 5
Synonyms: 1810018M11Rik, 1700027H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66262
Homologene: 90955
Glt1d1
Name: glycosyltransferase 1 domain containing 1
Synonyms: 5730455A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319804
Homologene: 16965
Rac2
Name: Rac family small GTPase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19354
VEGA: 15
HGNC: HGNC:9802
Homologene: 55699
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Fgfbp3
Name: fibroblast growth factor binding protein 3
Synonyms: 2610306H15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72514
Homologene: 49899
Vinac1
Name: vinculin/alpha-catenin family member 1
Synonyms: Gm14025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668894
Homologene: 86340
Sugct
Name: succinyl-CoA glutarate-CoA transferase
Synonyms: 5033411D12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192136
VEGA: 13
Homologene: 11681
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Parp3
Name: poly (ADP-ribose) polymerase family, member 3
Synonyms: Adprt3, PARP-3, A930002C11Rik, Adprtl3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235587
HGNC: HGNC:273
Homologene: 4005
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Kcnt1
Name: potassium channel, subfamily T, member 1
Synonyms: slo2, Slack, C030030G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227632
Homologene: 11055
Or10a49
Name: olfactory receptor family 10 subfamily A member 49
Synonyms: GA_x6K02T2PBJ9-11199311-11198367, MOR268-4, Olfr517
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258136
Homologene: 79413
Flg2
Name: filaggrin family member 2
Synonyms: EG229574
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229574
Homologene: 134146
Fam20b
Name: FAM20B, glycosaminoglycan xylosylkinase
Synonyms: C530043G21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215015
Homologene: 8909
Trim28
Name: tripartite motif-containing 28
Synonyms: KRIP-1, KAP-1, Tif1b, MommeD9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21849
Homologene: 21175
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
H2-T24
Name: histocompatibility 2, T region locus 24
Synonyms: H-2T24
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15042
Homologene: 69019
Cyp2c65
Name: cytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms: 2210009K14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72303
HGNC: HGNC:2622
Homologene: 133566
Paqr8
Name: progestin and adipoQ receptor family member VIII
Synonyms: 3110001D06Rik, 1700019B16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74229
Homologene: 32702
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Catsper3
Name: cation channel, sperm associated 3
Synonyms: 4921522D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76856
Homologene: 12658
Cnppd1
Name: cyclin Pas1/PHO80 domain containing 1
Synonyms: 1810031K17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69171
Homologene: 9238
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Cdk9
Name: cyclin dependent kinase 9
Synonyms: PITALRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107951
HGNC: HGNC:1780
Homologene: 55566
Gpr180
Name: G protein-coupled receptor 180
Synonyms: ITR, E130016I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58245
VEGA: 14
Homologene: 32506
Ckmt2
Name: creatine kinase, mitochondrial 2
Synonyms: 2300008A19Rik, ScCKmit
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76722
HGNC: HGNC:1996
Homologene: 68206
Cnnm4
Name: cyclin M4
Synonyms: Acdp4, 5430430O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94220
HGNC: HGNC:105
Homologene: 75662
Dync2li1
Name: dynein cytoplasmic 2 light intermediate chain 1
Synonyms: mD2LIC, CGI-60, LIC3, 4933404O11Rik, D2lic
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213575
VEGA: 17
Homologene: 9336
Mpp4
Name: membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Synonyms: DLG6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227157
Homologene: 23296
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Tent5a
Name: terminal nucleotidyltransferase 5A
Synonyms: D930050G01Rik, BAP014, Fam46a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 212943
Homologene: 23032
Klk15
Name: kallikrein related-peptidase 15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317652
Homologene: 77571
Or1af1
Name: olfactory receptor family 1 subfamily AF member 1
Synonyms: GA_x6K02T2NLDC-33902472-33903401, MOR138-5P, MOR138-6, Olfr366
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 236509
Homologene: 114744
Prdm12
Name: PR domain containing 12
Synonyms: LOC381359
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381359
Homologene: 10999
Mrpl1
Name: mitochondrial ribosomal protein L1
Synonyms: 2410002L03Rik, 5830418D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 94061
Homologene: 41355
Nat8f6
Name: N-acetyltransferase 8 (GCN5-related) family member 6
Synonyms: Gm11128
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100504710
Homologene: 76450
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,935,651 bp
  • A to T, chromosome 1 at 36,472,177 bp
  • A to T, chromosome 1 at 59,124,674 bp
  • T to C, chromosome 1 at 75,139,617 bp
  • T to G, chromosome 1 at 93,811,783 bp
  • T to C, chromosome 1 at 156,681,514 bp
  • A to G, chromosome 2 at 25,911,062 bp
  • A to G, chromosome 2 at 31,640,253 bp
  • G to T, chromosome 2 at 32,707,994 bp
  • A to T, chromosome 2 at 37,219,977 bp
  • A to G, chromosome 2 at 118,441,181 bp
  • A to T, chromosome 2 at 129,037,420 bp
  • C to T, chromosome 2 at 150,950,209 bp
  • G to A, chromosome 3 at 59,336,422 bp
  • C to T, chromosome 3 at 82,106,001 bp
  • C to T, chromosome 3 at 93,202,201 bp
  • A to G, chromosome 4 at 34,551,072 bp
  • A to G, chromosome 4 at 58,875,533 bp
  • T to A, chromosome 4 at 136,945,915 bp
  • A to T, chromosome 4 at 149,191,195 bp
  • A to T, chromosome 4 at 156,217,777 bp
  • C to A, chromosome 5 at 96,213,860 bp
  • T to A, chromosome 5 at 96,545,045 bp
  • A to G, chromosome 5 at 114,211,092 bp
  • T to A, chromosome 5 at 114,804,234 bp
  • T to C, chromosome 5 at 125,783,467 bp
  • T to A, chromosome 5 at 127,677,277 bp
  • A to G, chromosome 6 at 40,463,155 bp
  • A to G, chromosome 6 at 85,808,648 bp
  • C to A, chromosome 6 at 116,258,938 bp
  • C to T, chromosome 6 at 135,377,278 bp
  • G to A, chromosome 7 at 13,029,563 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • T to C, chromosome 7 at 108,868,633 bp
  • T to A, chromosome 7 at 123,462,590 bp
  • T to A, chromosome 8 at 48,236,196 bp
  • CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA to CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA, chromosome 8 at 66,860,494 bp
  • A to G, chromosome 9 at 44,848,615 bp
  • T to G, chromosome 9 at 85,326,335 bp
  • A to T, chromosome 9 at 106,473,692 bp
  • A to T, chromosome 9 at 109,105,218 bp
  • T to A, chromosome 10 at 75,859,536 bp
  • T to C, chromosome 10 at 127,546,399 bp
  • T to C, chromosome 11 at 4,214,885 bp
  • T to C, chromosome 11 at 116,283,509 bp
  • T to A, chromosome 13 at 17,452,486 bp
  • T to C, chromosome 13 at 55,798,892 bp
  • G to T, chromosome 13 at 91,863,192 bp
  • T to G, chromosome 13 at 97,118,459 bp
  • A to G, chromosome 14 at 31,707,277 bp
  • G to A, chromosome 14 at 118,158,043 bp
  • T to C, chromosome 15 at 78,566,023 bp
  • T to G, chromosome 15 at 102,486,042 bp
  • A to G, chromosome 16 at 35,841,213 bp
  • T to A, chromosome 16 at 70,488,101 bp
  • T to A, chromosome 17 at 12,917,874 bp
  • T to C, chromosome 17 at 36,020,471 bp
  • A to T, chromosome 17 at 71,365,089 bp
  • A to G, chromosome 17 at 84,628,391 bp
  • C to T, chromosome 19 at 36,918,793 bp
  • A to T, chromosome 19 at 38,716,596 bp
  • C to T, chromosome 19 at 39,072,217 bp
  • G to A, chromosome 19 at 47,679,422 bp
  • T to C, chromosome X at 101,308,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9231 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068985-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.