Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9231Btlr/Mmmh
Stock Number:
068985-MU
Citation ID:
RRID:MMRRC_068985-MU
Other Names:
R9231 (G1)
Major Collection:

Strain Information

Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Galr2
Name: galanin receptor 2
Synonyms: mGalR, GalR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14428
HGNC: HGNC:4133
Homologene: 2863
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Fam169a
Name: family with sequence similarity 169, member A
Synonyms: B230112C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320557
VEGA: 13
Homologene: 52656
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Mif
Name: macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Synonyms: Glif
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17319
VEGA: 10
HGNC: HGNC:7097
Homologene: 55655
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,935,651 bp
  • A to T, chromosome 1 at 36,472,177 bp
  • A to T, chromosome 1 at 59,124,674 bp
  • T to C, chromosome 1 at 75,139,617 bp
  • T to G, chromosome 1 at 93,811,783 bp
  • T to C, chromosome 1 at 156,681,514 bp
  • A to G, chromosome 2 at 25,911,062 bp
  • A to G, chromosome 2 at 31,640,253 bp
  • G to T, chromosome 2 at 32,707,994 bp
  • A to T, chromosome 2 at 37,219,977 bp
  • A to G, chromosome 2 at 118,441,181 bp
  • A to T, chromosome 2 at 129,037,420 bp
  • C to T, chromosome 2 at 150,950,209 bp
  • G to A, chromosome 3 at 59,336,422 bp
  • C to T, chromosome 3 at 82,106,001 bp
  • C to T, chromosome 3 at 93,202,201 bp
  • A to G, chromosome 4 at 34,551,072 bp
  • A to G, chromosome 4 at 58,875,533 bp
  • T to A, chromosome 4 at 136,945,915 bp
  • A to T, chromosome 4 at 149,191,195 bp
  • A to T, chromosome 4 at 156,217,777 bp
  • C to A, chromosome 5 at 96,213,860 bp
  • T to A, chromosome 5 at 96,545,045 bp
  • A to G, chromosome 5 at 114,211,092 bp
  • T to A, chromosome 5 at 114,804,234 bp
  • T to C, chromosome 5 at 125,783,467 bp
  • T to A, chromosome 5 at 127,677,277 bp
  • A to G, chromosome 6 at 40,463,155 bp
  • A to G, chromosome 6 at 85,808,648 bp
  • C to A, chromosome 6 at 116,258,938 bp
  • C to T, chromosome 6 at 135,377,278 bp
  • G to A, chromosome 7 at 13,029,563 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • T to C, chromosome 7 at 108,868,633 bp
  • T to A, chromosome 7 at 123,462,590 bp
  • T to A, chromosome 8 at 48,236,196 bp
  • CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA to CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA, chromosome 8 at 66,860,494 bp
  • A to G, chromosome 9 at 44,848,615 bp
  • T to G, chromosome 9 at 85,326,335 bp
  • A to T, chromosome 9 at 106,473,692 bp
  • A to T, chromosome 9 at 109,105,218 bp
  • T to A, chromosome 10 at 75,859,536 bp
  • T to C, chromosome 10 at 127,546,399 bp
  • T to C, chromosome 11 at 4,214,885 bp
  • T to C, chromosome 11 at 116,283,509 bp
  • T to A, chromosome 13 at 17,452,486 bp
  • T to C, chromosome 13 at 55,798,892 bp
  • G to T, chromosome 13 at 91,863,192 bp
  • T to G, chromosome 13 at 97,118,459 bp
  • A to G, chromosome 14 at 31,707,277 bp
  • G to A, chromosome 14 at 118,158,043 bp
  • T to C, chromosome 15 at 78,566,023 bp
  • T to G, chromosome 15 at 102,486,042 bp
  • A to G, chromosome 16 at 35,841,213 bp
  • T to A, chromosome 16 at 70,488,101 bp
  • T to A, chromosome 17 at 12,917,874 bp
  • T to C, chromosome 17 at 36,020,471 bp
  • A to T, chromosome 17 at 71,365,089 bp
  • A to G, chromosome 17 at 84,628,391 bp
  • C to T, chromosome 19 at 36,918,793 bp
  • A to T, chromosome 19 at 38,716,596 bp
  • C to T, chromosome 19 at 39,072,217 bp
  • G to A, chromosome 19 at 47,679,422 bp
  • T to C, chromosome X at 101,308,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9231 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068985-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.