Strain Name:
C57BL/6J-MtgxR7870Btlr/Mmmh
Stock Number:
045922-MU
Citation ID:
RRID:MMRRC_045922-MU
Other Names:
R7870 (G1)
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MyHC-I, MYH-beta/slow, Myhc-b, Myhcb, betaMHC, beta-MHC, B-MHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Pcdh9
Name: protocadherin 9
Synonyms: A730003J17Rik, 1500001L12Rik, C630029H24Rik, C530050I23Rik, LOC382930
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211712
HGNC: HGNC:8661
Homologene: 10698
Kcnj1
Name: potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms: Kir1.1, ROMK-2, ROMK
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56379
VEGA: 9
HGNC: HGNC:6255
Homologene: 56764
Alox12b
Name: arachidonate 12-lipoxygenase, 12R type
Synonyms: Aloxe2, e-LOX2, 12R-LOX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11686
HGNC: HGNC:430
Homologene: 884
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Stau1
Name: staufen double-stranded RNA binding protein 1
Synonyms: 5830401L18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20853
Homologene: 3384
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, mindbomb, skeletrophin, Mib, mind bomb-1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2D, A2LG, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Sap130
Name: Sin3A associated protein
Synonyms: 2610304F09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269003
VEGA: 18
Homologene: 11577
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Sh2bp1, Tsbp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Thbs1
Name: thrombospondin 1
Synonyms: Thbs-1, tbsp1, TSP1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Slit2
Name: slit guidance ligand 2
Synonyms: E030015M03Rik, E130320P19Rik, b2b1200.1Clo, Slil3, Drad-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Rax
Name: retina and anterior neural fold homeobox
Synonyms: ey1, E130303K03Rik, Rx
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19434
VEGA: 18
Homologene: 8383
H3f3a
Name: H3.3 histone A
Synonyms: H3-3a, H3.3A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15078
Homologene: 134170
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Alb
Name: albumin
Synonyms: Alb1, Alb-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Chrdl2
Name: chordin-like 2
Synonyms: 1810022C01Rik, Chl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69121
Homologene: 128795
Htt
Name: huntingtin
Synonyms: huntingtin, htt, IT15, Hdh, HD, C430023I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Sez6l
Name: seizure related 6 homolog like
Synonyms: Acig1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56747
Homologene: 10895
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, D030022P06Rik, B930091H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Rdh9
Name: retinol dehydrogenase 9
Synonyms: Crad3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103142
Homologene: 129514
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: 4921531P07Rik, Dnahc12, DHC3, HL19, DLP12, HL-19, Hdhc3, Dnahc7l, LOC380889
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Cdkl3
Name: cyclin dependent kinase like 3
Synonyms: B230379H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213084
Homologene: 49467
Or5h17
Name: olfactory receptor family 5 subfamily H member 17
Synonyms: Olfr183, MOR183-2, GA_x54KRFPKG5P-55229158-55230087
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258478
Homologene: 27178
Or52z13
Name: olfactory receptor family 52 subfamily Z member 13
Synonyms: MOR31-9, Olfr618, GA_x6K02T2PBJ9-6320148-6321104
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259049
Homologene: 72966
1700017N19Rik
Name: RIKEN cDNA 1700017N19 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66605
Homologene: 45135
Flnc
Name: filamin C, gamma
Synonyms: actin binding protein 280, 1110055E19Rik, Fln2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Snap47
Name: synaptosomal-associated protein, 47
Synonyms: 1110031B06Rik, SNAP-47
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67826
Homologene: 14206
Nfil3
Name: nuclear factor, interleukin 3, regulated
Synonyms: E4BP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18030
HGNC: HGNC:7787
Homologene: 3928
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Mymk
Name: myomaker, myoblast fusion factor
Synonyms: 1110002H13Rik, Tmem8c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66139
Homologene: 11925
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: 9130201M22Rik, Semaf, semF, M-Sema D
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: Caps2, cpd2, A230044C21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320405
Homologene: 23060
Zfp598
Name: zinc finger protein 598
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Plbd1
Name: phospholipase B domain containing 1
Synonyms: 1100001H23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66857
Homologene: 11745
Tfpi2
Name: tissue factor pathway inhibitor 2
Synonyms: PP5/TFPI-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21789
Homologene: 38194
Vdr
Name: vitamin D (1,25-dihydroxyvitamin D3) receptor
Synonyms: Nr1i1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22337
Homologene: 37297
2410137M14Rik
Name: RIKEN cDNA 2410137M14 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76797
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il18ralpha, Il1rrp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Zfp354c
Name: zinc finger protein 354C
Synonyms: Kid3, AJ18, 5330421P20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Cyp2c67
Name: cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms: C730004C24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545288
Homologene: 74936
Or4d5
Name: olfactory receptor family 4 subfamily D member 5
Synonyms: MOR239-6, GA_x6K02T2PVTD-33799484-33798540, Olfr984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258601
VEGA: 9
Homologene: 17314
Pcyox1
Name: prenylcysteine oxidase 1
Synonyms: Pcly, 1200015P13Rik, PCL1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66881
Homologene: 9458
Nyap1
Name: neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms: 6430598A04Rik, Nyap1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243300
Homologene: 18320
Vmn1r123
Name: vomeronasal 1 receptor 123
Synonyms: LOC384695, Gm1446
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384695
Homologene: 104166
Pars2
Name: prolyl-tRNA synthetase (mitochondrial)(putative)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230577
Homologene: 5830
Tmem65
Name: transmembrane protein 65
Synonyms: 2610029O13Rik, 4930438D12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74868
Homologene: 45494
Cygb
Name: cytoglobin
Synonyms: Staap, 3110001K20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114886
Homologene: 12706
Mettl21e
Name: methyltransferase like 21E
Synonyms: LOC381340, 4832428D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 403183
Homologene: 19006
Gm29106
Name: predicted gene 29106
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,491,136 bp
  • T to A, chromosome 1 at 44,210,211 bp
  • T to A, chromosome 1 at 118,199,155 bp
  • A to T, chromosome 1 at 180,811,925 bp
  • A to G, chromosome 2 at 27,062,286 bp
  • G to A, chromosome 2 at 52,325,749 bp
  • A to T, chromosome 2 at 118,115,027 bp
  • G to T, chromosome 2 at 166,950,950 bp
  • A to G, chromosome 2 at 181,996,113 bp
  • G to T, chromosome 4 at 98,424,316 bp
  • T to A, chromosome 4 at 106,654,079 bp
  • T to A, chromosome 5 at 34,898,547 bp
  • C to A, chromosome 5 at 48,302,307 bp
  • T to C, chromosome 5 at 90,472,629 bp
  • T to G, chromosome 5 at 112,438,581 bp
  • G to C, chromosome 5 at 137,735,396 bp
  • A to G, chromosome 6 at 3,968,281 bp
  • G to T, chromosome 6 at 23,263,642 bp
  • C to T, chromosome 6 at 29,454,307 bp
  • G to A, chromosome 6 at 86,392,341 bp
  • A to T, chromosome 6 at 136,617,328 bp
  • C to T, chromosome 7 at 21,162,267 bp
  • C to A, chromosome 7 at 35,211,497 bp
  • T to C, chromosome 7 at 100,010,042 bp
  • T to A, chromosome 7 at 103,598,266 bp
  • A to G, chromosome 7 at 111,052,411 bp
  • A to G, chromosome 7 at 126,492,752 bp
  • G to A, chromosome 7 at 127,560,558 bp
  • G to A, chromosome 9 at 32,396,585 bp
  • A to C, chromosome 9 at 40,100,677 bp
  • T to A, chromosome 10 at 100,605,643 bp
  • C to A, chromosome 10 at 127,776,697 bp
  • TGTCACACTCG to TG, chromosome 11 at 50,815,238 bp
  • T to C, chromosome 11 at 52,018,457 bp
  • T to C, chromosome 11 at 59,438,078 bp
  • T to C, chromosome 11 at 69,169,309 bp
  • T to C, chromosome 11 at 77,453,615 bp
  • T to A, chromosome 11 at 116,649,290 bp
  • G to T, chromosome 12 at 72,486,190 bp
  • A to G, chromosome 13 at 52,968,413 bp
  • A to G, chromosome 14 at 26,856,529 bp
  • A to G, chromosome 14 at 31,172,095 bp
  • C to G, chromosome 14 at 54,988,801 bp
  • A to T, chromosome 14 at 93,887,257 bp
  • A to T, chromosome 15 at 23,474,327 bp
  • A to T, chromosome 15 at 32,609,339 bp
  • A to T, chromosome 15 at 58,787,161 bp
  • T to G, chromosome 15 at 97,884,890 bp
  • G to A, chromosome 16 at 58,999,723 bp
  • TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC to TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC, chromosome 16 at 91,656,598 bp
  • A to G, chromosome 17 at 24,679,330 bp
  • A to G, chromosome 17 at 25,860,539 bp
  • A to T, chromosome 17 at 36,978,017 bp
  • G to A, chromosome 18 at 10,798,446 bp
  • A to G, chromosome 18 at 31,720,661 bp
  • A to G, chromosome 18 at 65,938,213 bp
  • G to T, chromosome 19 at 18,815,241 bp
  • A to C, chromosome 19 at 39,609,225 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7870 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045922-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.