Strain Name:
C57BL/6J-MtgxR1647Btlr/Mmmh
Stock Number:
039683-MU
Citation ID:
RRID:MMRRC_039683-MU
Other Names:
R1647 (G1), C57BL/6J-MtgxR1647Btlr
Major Collection:

Strain Information

Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: prestin, Pres
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170753
Homologene: 64370
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68145
Homologene: 10369
Setd2
Name: SET domain containing 2
Synonyms: KMT3A, 4921524K10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Kif20b
Name: kinesin family member 20B
Synonyms: 33cex, N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Prr12
Name: proline rich 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233210
Homologene: 18957
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: GMAP-210, TRIP230, 3110031G15Rik, 6030460N08Rik, 2610511G22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, Iars, 2510016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Lamb2
Name: laminin, beta 2
Synonyms: Lams, npht, Lamb-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: Nr3a1, ESR, ER-alpha, ERalpha, Estr, ER[a], Estra, ERa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Phldb1
Name: pleckstrin homology like domain, family B, member 1
Synonyms: D330037A14Rik, LL5A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102693
Homologene: 15903
Klc1
Name: kinesin light chain 1
Synonyms: Kns2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16593
HGNC: HGNC:6387
Homologene: 4056
Exosc8
Name: exosome component 8
Synonyms: 2310032N20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69639
Homologene: 12323
Pnkp
Name: polynucleotide kinase 3'- phosphatase
Synonyms: 1810009G08Rik, PNK
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 59047
HGNC: HGNC:9154
Homologene: 5247
Il22ra1
Name: interleukin 22 receptor, alpha 1
Synonyms: Il22r
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230828
Homologene: 10943
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Wcrf180, Acf1, Gtl5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Cep170b
Name: centrosomal protein 170B
Synonyms: AW555464
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217882
VEGA: 12
Homologene: 46165
Prrg4
Name: proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
Synonyms: TMG4, 9930111I18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228413
Homologene: 11451
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Ceacam18
Name: CEA cell adhesion molecule 18
Synonyms: 2010110O04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72431
Homologene: 48111
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210510
Homologene: 19364
Plcb2
Name: phospholipase C, beta 2
Synonyms: B230205M18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18796
HGNC: HGNC:9055
Homologene: 20957
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Ppp2r1b
Name: protein phosphatase 2, regulatory subunit A, beta
Synonyms: 2410091N08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73699
HGNC: HGNC:9303
Homologene: 70244
4921528O07Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: Gm1557, 4930503E15Rik, LOC380658
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140887
Homologene: 17737
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Entpd7
Name: ectonucleoside triphosphate diphosphohydrolase 7
Synonyms: 1810012B13Rik, 2810003F23Rik, 1810020C02Rik, LALP1, Lysal2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 93685
Homologene: 122202
Slc39a12
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277468
Homologene: 17654
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Shc2
Name: SHC (Src homology 2 domain containing) transforming protein 2
Synonyms: Sli, ShcB
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216148
Homologene: 19127
Pygl
Name: liver glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110095
HGNC: HGNC:9725
Homologene: 84371
Krt84
Name: keratin 84
Synonyms: HRb-1, Krt2-16, Krt2-3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Slc45a3
Name: solute carrier family 45, member 3
Synonyms: 2210413P12Rik, IPCA-6, Pcanap6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212980
HGNC: HGNC:8642
Homologene: 23813
Chrm3
Name: cholinergic receptor, muscarinic 3, cardiac
Synonyms: Chrm-3, muscarinic acetylcholine receptor 3, M3R
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12671
HGNC: HGNC:1952
Homologene: 20191
Has1
Name: hyaluronan synthase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15116
VEGA: 17
HGNC: HGNC:4818
Homologene: 1165
Dcaf7
Name: DDB1 and CUL4 associated factor 7
Synonyms: 1700012F10Rik, 2610037L01Rik, Wdr68
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71833
Homologene: 55930
Miip
Name: migration and invasion inhibitory protein
Synonyms: D4Wsu114e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 28010
Homologene: 15879
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: Grfbeta, CDC25, Grf1, CDC25Mm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
G930045G22Rik
Name: RIKEN cDNA G930045G22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Spata2l
Name: spermatogenesis associated 2-like
Synonyms: 2610039E05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78779
Homologene: 32729
4930522H14Rik
Name: RIKEN cDNA 4930522H14 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67646
Homologene: 49856
Or51a10
Name: olfactory receptor family 51 subfamily A member 10
Synonyms: GA_x6K02T2PBJ9-6784380-6783436, Olfr642, MOR13-6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258326
Homologene: 17196
Hk3
Name: hexokinase 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212032
HGNC: HGNC:4925
Homologene: 55633
Rps6ka4
Name: ribosomal protein S6 kinase, polypeptide 4
Synonyms: 90kDa, MSK2, 1110069D02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56613
VEGA: 19
Homologene: 69288
Atp8b2
Name: ATPase, class I, type 8B, member 2
Synonyms: Id
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54667
Homologene: 23226
Eif2b5
Name: eukaryotic translation initiation factor 2B, subunit 5 epsilon
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224045
HGNC: HGNC:3261
Homologene: 2903
Anxa10
Name: annexin A10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26359
HGNC: HGNC:534
Homologene: 21409
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: MOR214-2, GA_x6K02T2RE5P-2634596-2633658, Olfr1436
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Rasd1
Name: RAS, dexamethasone-induced 1
Synonyms: Dexras1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19416
Homologene: 7509
Cnn1
Name: calponin 1
Synonyms: calponin h1, CN, CnnI
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12797
VEGA: 9
HGNC: HGNC:2155
Homologene: 995
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: Olfr519, MOR268-6, GA_x6K02T2PBJ9-11224559-11223615
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
Sbspon
Name: somatomedin B and thrombospondin, type 1 domain containing
Synonyms: LOC226866, Gm106
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226866
Homologene: 45950
Gm13703
Name: predicted gene 13703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Sdhaf3
Name: succinate dehydrogenase complex assembly factor 3
Synonyms: 0610005M07Rik, 4933430A16Rik, Acn9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71238
Homologene: 41349
Tmem190
Name: transmembrane protein 190
Synonyms: 4930572D21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78052
Homologene: 44548
Lsm4
Name: LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50783
Homologene: 134555
Pate9
Name: prostate and testis expressed 9
Synonyms: Gm5615
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434396
Nkx2-3
Name: NK2 homeobox 3
Synonyms: tinman, Nkx2.3, Nkx-2.3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18089
HGNC: HGNC:7836
Homologene: 17061
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 15,883,759 bp
  • G to A, chromosome 1 at 131,977,524 bp
  • T to G, chromosome 1 at 163,046,056 bp
  • T to C, chromosome 2 at 14,451,992 bp
  • T to C, chromosome 2 at 73,364,164 bp
  • T to C, chromosome 2 at 90,710,088 bp
  • C to A, chromosome 2 at 104,832,743 bp
  • A to T, chromosome 2 at 118,723,780 bp
  • A to G, chromosome 2 at 161,042,058 bp
  • A to T, chromosome 3 at 9,471,039 bp
  • A to T, chromosome 3 at 54,734,101 bp
  • T to A, chromosome 3 at 55,630,229 bp
  • G to A, chromosome 3 at 89,941,784 bp
  • A to G, chromosome 3 at 133,485,880 bp
  • A to G, chromosome 4 at 109,505,571 bp
  • C to A, chromosome 4 at 135,750,460 bp
  • T to C, chromosome 4 at 147,865,234 bp
  • T to A, chromosome 5 at 21,813,976 bp
  • T to A, chromosome 5 at 66,999,256 bp
  • T to A, chromosome 5 at 96,726,613 bp
  • C to A, chromosome 5 at 147,027,342 bp
  • T to C, chromosome 6 at 6,956,126 bp
  • T to C, chromosome 6 at 50,846,718 bp
  • A to G, chromosome 7 at 4,784,121 bp
  • A to C, chromosome 7 at 43,639,265 bp
  • T to C, chromosome 7 at 44,861,303 bp
  • T to A, chromosome 7 at 45,034,192 bp
  • A to G, chromosome 7 at 104,050,169 bp
  • A to G, chromosome 7 at 108,893,765 bp
  • T to C, chromosome 8 at 62,092,584 bp
  • A to G, chromosome 8 at 70,677,806 bp
  • G to T, chromosome 8 at 81,856,774 bp
  • T to C, chromosome 8 at 123,233,302 bp
  • C to A, chromosome 9 at 22,107,854 bp
  • A to G, chromosome 9 at 36,534,440 bp
  • G to A, chromosome 9 at 44,715,433 bp
  • G to A, chromosome 9 at 50,866,819 bp
  • A to G, chromosome 9 at 62,760,370 bp
  • A to G, chromosome 9 at 89,953,920 bp
  • G to A, chromosome 9 at 108,481,423 bp
  • A to G, chromosome 9 at 110,549,864 bp
  • A to G, chromosome 10 at 5,001,260 bp
  • A to G, chromosome 10 at 10,395,371 bp
  • T to A, chromosome 10 at 79,626,111 bp
  • A to T, chromosome 10 at 103,170,648 bp
  • C to A, chromosome 11 at 17,946,492 bp
  • T to C, chromosome 11 at 59,964,094 bp
  • T to A, chromosome 11 at 106,051,802 bp
  • G to A, chromosome 12 at 54,975,198 bp
  • T to A, chromosome 12 at 70,197,010 bp
  • T to A, chromosome 12 at 101,884,392 bp
  • T to C, chromosome 12 at 111,776,887 bp
  • C to T, chromosome 12 at 112,736,372 bp
  • T to C, chromosome 12 at 119,446,421 bp
  • A to T, chromosome 13 at 9,878,425 bp
  • A to G, chromosome 13 at 49,723,002 bp
  • A to G, chromosome 13 at 55,014,461 bp
  • T to C, chromosome 15 at 90,994,367 bp
  • G to A, chromosome 15 at 101,525,963 bp
  • T to C, chromosome 16 at 20,502,585 bp
  • A to G, chromosome 17 at 17,849,985 bp
  • A to T, chromosome 17 at 22,569,061 bp
  • A to C, chromosome 17 at 43,627,109 bp
  • C to T, chromosome 17 at 87,672,636 bp
  • A to G, chromosome 18 at 12,532,199 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • C to A, chromosome 19 at 6,839,362 bp
  • T to A, chromosome 19 at 12,298,659 bp
  • A to T, chromosome 19 at 34,936,790 bp
  • A to T, chromosome 19 at 43,614,456 bp
  • A to G, chromosome 19 at 43,721,745 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1647 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039683-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.