Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1647Btlr/Mmmh
Stock Number:
039683-MU
Citation ID:
RRID:MMRRC_039683-MU
Other Names:
R1647 (G1), C57BL/6J-MtgxR1647Btlr
Major Collection:

Strain Information

Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170753
Homologene: 64370
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68145
Homologene: 10369
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 15,883,759 bp
  • G to A, chromosome 1 at 131,977,524 bp
  • T to G, chromosome 1 at 163,046,056 bp
  • T to C, chromosome 2 at 14,451,992 bp
  • T to C, chromosome 2 at 73,364,164 bp
  • T to C, chromosome 2 at 90,710,088 bp
  • C to A, chromosome 2 at 104,832,743 bp
  • A to T, chromosome 2 at 118,723,780 bp
  • A to G, chromosome 2 at 161,042,058 bp
  • A to T, chromosome 3 at 9,471,039 bp
  • A to T, chromosome 3 at 54,734,101 bp
  • T to A, chromosome 3 at 55,630,229 bp
  • G to A, chromosome 3 at 89,941,784 bp
  • A to G, chromosome 3 at 133,485,880 bp
  • A to G, chromosome 4 at 109,505,571 bp
  • C to A, chromosome 4 at 135,750,460 bp
  • T to C, chromosome 4 at 147,865,234 bp
  • T to A, chromosome 5 at 21,813,976 bp
  • T to A, chromosome 5 at 66,999,256 bp
  • T to A, chromosome 5 at 96,726,613 bp
  • C to A, chromosome 5 at 147,027,342 bp
  • T to C, chromosome 6 at 6,956,126 bp
  • T to C, chromosome 6 at 50,846,718 bp
  • A to G, chromosome 7 at 4,784,121 bp
  • A to C, chromosome 7 at 43,639,265 bp
  • T to C, chromosome 7 at 44,861,303 bp
  • T to A, chromosome 7 at 45,034,192 bp
  • A to G, chromosome 7 at 104,050,169 bp
  • A to G, chromosome 7 at 108,893,765 bp
  • T to C, chromosome 8 at 62,092,584 bp
  • A to G, chromosome 8 at 70,677,806 bp
  • G to T, chromosome 8 at 81,856,774 bp
  • T to C, chromosome 8 at 123,233,302 bp
  • C to A, chromosome 9 at 22,107,854 bp
  • A to G, chromosome 9 at 36,534,440 bp
  • G to A, chromosome 9 at 44,715,433 bp
  • G to A, chromosome 9 at 50,866,819 bp
  • A to G, chromosome 9 at 62,760,370 bp
  • A to G, chromosome 9 at 89,953,920 bp
  • G to A, chromosome 9 at 108,481,423 bp
  • A to G, chromosome 9 at 110,549,864 bp
  • A to G, chromosome 10 at 5,001,260 bp
  • A to G, chromosome 10 at 10,395,371 bp
  • T to A, chromosome 10 at 79,626,111 bp
  • A to T, chromosome 10 at 103,170,648 bp
  • C to A, chromosome 11 at 17,946,492 bp
  • T to C, chromosome 11 at 59,964,094 bp
  • T to A, chromosome 11 at 106,051,802 bp
  • G to A, chromosome 12 at 54,975,198 bp
  • T to A, chromosome 12 at 70,197,010 bp
  • T to A, chromosome 12 at 101,884,392 bp
  • T to C, chromosome 12 at 111,776,887 bp
  • C to T, chromosome 12 at 112,736,372 bp
  • T to C, chromosome 12 at 119,446,421 bp
  • A to T, chromosome 13 at 9,878,425 bp
  • A to G, chromosome 13 at 49,723,002 bp
  • A to G, chromosome 13 at 55,014,461 bp
  • T to C, chromosome 15 at 90,994,367 bp
  • G to A, chromosome 15 at 101,525,963 bp
  • T to C, chromosome 16 at 20,502,585 bp
  • A to G, chromosome 17 at 17,849,985 bp
  • A to T, chromosome 17 at 22,569,061 bp
  • A to C, chromosome 17 at 43,627,109 bp
  • C to T, chromosome 17 at 87,672,636 bp
  • A to G, chromosome 18 at 12,532,199 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • C to A, chromosome 19 at 6,839,362 bp
  • T to A, chromosome 19 at 12,298,659 bp
  • A to T, chromosome 19 at 34,936,790 bp
  • A to T, chromosome 19 at 43,614,456 bp
  • A to G, chromosome 19 at 43,721,745 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1647 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039683-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.