Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8258Btlr/Mmmh
Stock Number:
067684-MU
Citation ID:
RRID:MMRRC_067684-MU
Other Names:
R8258 (G1)
Major Collection:

Strain Information

Fgg
Name: fibrinogen gamma chain
Synonyms: gamma-fibrinogen, 3010002H13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99571
HGNC: HGNC:3694
Homologene: 429
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67886
Homologene: 18927
Abcg5
Name: ATP binding cassette subfamily G member 5
Synonyms: Sterolin-1, trac, cmp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27409
Homologene: 31909
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,558,192 bp
  • T to C, chromosome 1 at 26,682,481 bp
  • A to T, chromosome 1 at 74,732,055 bp
  • A to T, chromosome 1 at 136,280,339 bp
  • A to G, chromosome 1 at 170,968,133 bp
  • G to T, chromosome 1 at 182,565,133 bp
  • C to T, chromosome 3 at 83,010,170 bp
  • T to A, chromosome 3 at 89,232,034 bp
  • C to T, chromosome 4 at 106,591,662 bp
  • C to A, chromosome 4 at 128,617,699 bp
  • T to A, chromosome 5 at 150,059,900 bp
  • A to G, chromosome 6 at 40,444,180 bp
  • A to T, chromosome 6 at 140,637,727 bp
  • T to C, chromosome 7 at 25,358,423 bp
  • T to A, chromosome 7 at 26,267,261 bp
  • T to C, chromosome 7 at 27,519,383 bp
  • G to A, chromosome 7 at 64,269,029 bp
  • G to T, chromosome 7 at 73,435,784 bp
  • G to A, chromosome 7 at 96,867,991 bp
  • G to A, chromosome 8 at 127,371,540 bp
  • A to G, chromosome 9 at 15,990,591 bp
  • A to G, chromosome 9 at 56,259,393 bp
  • A to G, chromosome 9 at 96,825,580 bp
  • A to G, chromosome 9 at 109,234,695 bp
  • T to A, chromosome 9 at 123,964,082 bp
  • A to G, chromosome 10 at 25,171,156 bp
  • A to G, chromosome 10 at 58,455,933 bp
  • A to T, chromosome 10 at 60,315,656 bp
  • G to A, chromosome 10 at 75,614,832 bp
  • T to C, chromosome 11 at 75,302,724 bp
  • T to A, chromosome 11 at 75,523,863 bp
  • C to A, chromosome 12 at 75,949,369 bp
  • T to C, chromosome 12 at 102,254,669 bp
  • A to T, chromosome 12 at 108,510,199 bp
  • T to A, chromosome 13 at 76,801,547 bp
  • T to A, chromosome 13 at 91,859,216 bp
  • A to T, chromosome 13 at 100,316,412 bp
  • A to G, chromosome 14 at 55,863,358 bp
  • A to G, chromosome 14 at 108,911,221 bp
  • G to A, chromosome 15 at 4,911,909 bp
  • A to G, chromosome 15 at 78,776,684 bp
  • T to C, chromosome 15 at 102,715,793 bp
  • T to C, chromosome 16 at 59,216,095 bp
  • C to A, chromosome 17 at 25,839,890 bp
  • T to C, chromosome 17 at 37,923,956 bp
  • T to G, chromosome 17 at 84,676,095 bp
  • C to A, chromosome 17 at 90,163,821 bp
  • C to T, chromosome 19 at 5,665,384 bp
  • G to A, chromosome 19 at 6,249,829 bp
  • A to G, chromosome 19 at 9,893,629 bp
  • G to C, chromosome 19 at 9,893,641 bp
  • T to C, chromosome 19 at 12,954,363 bp
  • A to G, chromosome 19 at 17,212,308 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
  • G to C, chromosome X at 101,793,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8258 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067684-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.