Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8258Btlr/Mmmh
Stock Number:
067684-MU
Citation ID:
RRID:MMRRC_067684-MU
Other Names:
R8258 (G1)
Major Collection:

Strain Information

Fgg
Name: fibrinogen gamma chain
Synonyms: gamma-fibrinogen, 3010002H13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99571
HGNC: HGNC:3694
Homologene: 429
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67886
Homologene: 18927
Abcg5
Name: ATP binding cassette subfamily G member 5
Synonyms: Sterolin-1, trac, cmp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27409
Homologene: 31909
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Pxylp1
Name: 2-phosphoxylose phosphatase 1
Synonyms: C130099A20Rik, 9430094M07Rik, Acpl2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235534
Homologene: 15931
Calcoco1
Name: calcium binding and coiled coil domain 1
Synonyms: 1810009B06Rik, CoCoA, Gcap11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67488
Homologene: 10845
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Akap7
Name: A kinase anchor protein 7
Synonyms: Akap18, AKAP15
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432442
HGNC: HGNC:377
Homologene: 49463
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104401
Homologene: 17000
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, NKF3 kinase family member, C230081A13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Slitrk1
Name: SLIT and NTRK-like family, member 1
Synonyms: 3200001I04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76965
VEGA: 14
Homologene: 14174
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Ccr1
Name: C-C motif chemokine receptor 1
Synonyms: Cmkbr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12768
VEGA: 9
HGNC: HGNC:1602
Homologene: 20344
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Nynrin
Name: NYN domain and retroviral integrase containing
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 277154
VEGA: 14
Homologene: 19483
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Eml1
Name: echinoderm microtubule associated protein like 1
Synonyms: ELP79, 1110008N23Rik, A930030P13Rik, heco
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68519
HGNC: HGNC:3330
Homologene: 20931
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Capn8
Name: calpain 8
Synonyms: nCL-2', nCL-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170725
HGNC: HGNC:1485
Homologene: 15643
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Scarf1
Name: scavenger receptor class F, member 1
Synonyms: SREC, SREC-I
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380713
Homologene: 2741
Adhfe1
Name: alcohol dehydrogenase, iron containing, 1
Synonyms: 6330565B14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76187
Homologene: 5865
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Cyp27a1
Name: cytochrome P450, family 27, subfamily a, polypeptide 1
Synonyms: cholesterol 27 hydroxylase, Cyp27, 1300013A03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 104086
HGNC: HGNC:2605
Homologene: 36040
Or5b98
Name: olfactory receptor family 5 subfamily B member 98
Synonyms: GA_x6K02T2RE5P-3283121-3284098, MOR202-33, Olfr1450
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258368
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik, A230068P09Rik, 9330127H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78771
Homologene: 75211
Rxfp2
Name: relaxin/insulin-like family peptide receptor 2
Synonyms: Great, LGR8, Gpr106
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140498
Homologene: 15402
Slc24a4
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 4
Synonyms: NCKX4, A930002M03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238384
Homologene: 17798
Cimap2
Name: ciliary microtubule associated protein 2
Synonyms: BC055111, Lexm
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242602
Homologene: 17630
Vmn1r184
Name: vomeronasal 1 receptor, 184
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312477
Homologene: 74353
Ckmt2
Name: creatine kinase, mitochondrial 2
Synonyms: 2300008A19Rik, ScCKmit
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76722
HGNC: HGNC:1996
Homologene: 68206
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Or14j7
Name: olfactory receptor family 14 subfamily J member 7
Synonyms: GA_x6K02T2PSCP-2374126-2375048, MOR218-13, Olfr128
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383243
Homologene: 134080
Prx
Name: periaxin
Synonyms: L-Periaxin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19153
Homologene: 76542
Card10
Name: caspase recruitment domain family, member 10
Synonyms: CARMA3, Bimp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105844
Homologene: 8728
Rhot2
Name: ras homolog family member T2
Synonyms: Miro2, Arht2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214952
Homologene: 56038
Ggt5
Name: gamma-glutamyltransferase 5
Synonyms: GGT-REL, GGL, gamma-glutamyl leukotrienase, Ggtla1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23887
HGNC: HGNC:4260
Homologene: 55802
Fbxw20
Name: F-box and WD-40 domain protein 20
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434440
Homologene: 110776
Muc1
Name: mucin 1, transmembrane
Synonyms: EMA, CD227, Muc-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17829
HGNC: HGNC:7508
Homologene: 137248
Or5ac17
Name: olfactory receptor family 5 subfamily AC member 17
Synonyms: GA_x54KRFPKG5P-55430495-55429569, MOR182-14, Olfr199
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 404310
Homologene: 37011
Fcgr2b
Name: Fc receptor, IgG, low affinity IIb
Synonyms: CD32, FcgRII, Fc[g]RII, Fc gamma RIIB, FcgammaRIIB, Fcgr2, Fcr-2, Ly-m20, Ly-17, LyM-1, Fcr-3, Fcgr2a, F630109E10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14130
Homologene: 2974
Tlr12
Name: toll-like receptor 12
Synonyms: LOC384059, Tlr11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384059
Homologene: 135964
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,558,192 bp
  • T to C, chromosome 1 at 26,682,481 bp
  • A to T, chromosome 1 at 74,732,055 bp
  • A to T, chromosome 1 at 136,280,339 bp
  • A to G, chromosome 1 at 170,968,133 bp
  • G to T, chromosome 1 at 182,565,133 bp
  • C to T, chromosome 3 at 83,010,170 bp
  • T to A, chromosome 3 at 89,232,034 bp
  • C to T, chromosome 4 at 106,591,662 bp
  • C to A, chromosome 4 at 128,617,699 bp
  • T to A, chromosome 5 at 150,059,900 bp
  • A to G, chromosome 6 at 40,444,180 bp
  • A to T, chromosome 6 at 140,637,727 bp
  • T to C, chromosome 7 at 25,358,423 bp
  • T to A, chromosome 7 at 26,267,261 bp
  • T to C, chromosome 7 at 27,519,383 bp
  • G to A, chromosome 7 at 64,269,029 bp
  • G to T, chromosome 7 at 73,435,784 bp
  • G to A, chromosome 7 at 96,867,991 bp
  • G to A, chromosome 8 at 127,371,540 bp
  • A to G, chromosome 9 at 15,990,591 bp
  • A to G, chromosome 9 at 56,259,393 bp
  • A to G, chromosome 9 at 96,825,580 bp
  • A to G, chromosome 9 at 109,234,695 bp
  • T to A, chromosome 9 at 123,964,082 bp
  • A to G, chromosome 10 at 25,171,156 bp
  • A to G, chromosome 10 at 58,455,933 bp
  • A to T, chromosome 10 at 60,315,656 bp
  • G to A, chromosome 10 at 75,614,832 bp
  • T to C, chromosome 11 at 75,302,724 bp
  • T to A, chromosome 11 at 75,523,863 bp
  • C to A, chromosome 12 at 75,949,369 bp
  • T to C, chromosome 12 at 102,254,669 bp
  • A to T, chromosome 12 at 108,510,199 bp
  • T to A, chromosome 13 at 76,801,547 bp
  • T to A, chromosome 13 at 91,859,216 bp
  • A to T, chromosome 13 at 100,316,412 bp
  • A to G, chromosome 14 at 55,863,358 bp
  • A to G, chromosome 14 at 108,911,221 bp
  • G to A, chromosome 15 at 4,911,909 bp
  • A to G, chromosome 15 at 78,776,684 bp
  • T to C, chromosome 15 at 102,715,793 bp
  • T to C, chromosome 16 at 59,216,095 bp
  • C to A, chromosome 17 at 25,839,890 bp
  • T to C, chromosome 17 at 37,923,956 bp
  • T to G, chromosome 17 at 84,676,095 bp
  • C to A, chromosome 17 at 90,163,821 bp
  • C to T, chromosome 19 at 5,665,384 bp
  • G to A, chromosome 19 at 6,249,829 bp
  • A to G, chromosome 19 at 9,893,629 bp
  • G to C, chromosome 19 at 9,893,641 bp
  • T to C, chromosome 19 at 12,954,363 bp
  • A to G, chromosome 19 at 17,212,308 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
  • G to C, chromosome X at 101,793,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8258 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067684-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.