Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8925Btlr/Mmmh
Stock Number:
068708-MU
Citation ID:
RRID:MMRRC_068708-MU
Other Names:
R8925 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Gnb5
Name: guanine nucleotide binding protein (G protein), beta 5
Synonyms: G beta 5, Gbeta5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14697
VEGA: 9
HGNC: HGNC:4401
Homologene: 40714
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: Enx-1, Enx1h, KMT6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: Asr2, Ars2, 2810019G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194401
Homologene: 85288
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Nedd1
Name: neural precursor cell expressed, developmentally down-regulated gene 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17997
VEGA: 10
HGNC: HGNC:7723
Homologene: 7439
L3mbtl3
Name: L3MBTL3 histone methyl-lysine binding protein
Synonyms: MBT-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237339
Homologene: 18226
Pyroxd1
Name: pyridine nucleotide-disulphide oxidoreductase domain 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232491
Homologene: 11758
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Foxo1
Name: forkhead box O1
Synonyms: FKHR, Fkhr1, Afxh, Foxo1a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56458
HGNC: HGNC:3819
Homologene: 1527
1700017B05Rik
Name: RIKEN cDNA 1700017B05 gene
Synonyms: D9Ertd278e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74211
VEGA: 9
Homologene: 19283
Slc25a36
Name: solute carrier family 25, member 36
Synonyms: C330005L02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192287
Homologene: 10039
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Gckr
Name: glucokinase regulatory protein
Synonyms: GKRP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231103
HGNC: HGNC:4196
Homologene: 1139
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Or4k51
Name: olfactory receptor family 4 subfamily K member 51
Synonyms: GA_x6K02T2Q125-72805651-72806589, MOR248-5, Olfr1301
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258889
Homologene: 74057
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Clec4a3
Name: C-type lectin domain family 4, member a3
Synonyms: 3110037K17Rik, mDcir3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73149
Homologene: 9413
Oscar
Name: osteoclast associated receptor
Synonyms: mOSCAR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232790
Homologene: 77042
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Plppr5
Name: phospholipid phosphatase related 5
Synonyms: Lppr5, 4833424O15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75769
Homologene: 25279
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NMDAR2B, NR2B, Nmdar2b, GluRepsilon2, GluN2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Fmo2
Name: flavin containing monooxygenase 2
Synonyms: 2310008D08Rik, 2310042I22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 55990
HGNC: HGNC:3770
Homologene: 86882
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Kif2b
Name: kinesin family member 2B
Synonyms: 1700063D03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73470
Homologene: 23775
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Tarm1
Name: T cell-interacting, activating receptor on myeloid cells 1
Synonyms: 9930022N03Rik, Gm9904
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245126
Homologene: 120241
Tektl1
Name: tektin like 1
Synonyms: 4931413A09Rik, Ccdc105
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70976
VEGA: 10
Homologene: 18299
Itga1
Name: integrin alpha 1
Synonyms: CD49A, Vla1, E130012M19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109700
VEGA: 13
HGNC: HGNC:6134
Homologene: 57137
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Fam83a
Name: family with sequence similarity 83, member A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239463
Homologene: 13158
Vsig10l
Name: V-set and immunoglobulin domain containing 10 like
Synonyms: 2210412E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75690
Homologene: 35386
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Nxpe3
Name: neurexophilin and PC-esterase domain family, member 3
Synonyms: LOC208684, LOC385658, Fam55c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385658
VEGA: 16
Homologene: 17030
Or9s14
Name: olfactory receptor family 9 subfamily S member 14
Synonyms: GA_x6K02T2R7CC-81146179-81145211, MOR208-2, Olfr1410
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258484
Homologene: 74205
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Rab13
Name: RAB13, member RAS oncogene family
Synonyms: B230212B15Rik, 0610007N03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68328
HGNC: HGNC:9762
Homologene: 113882
Or2a7
Name: olfactory receptor family 2 subfamily A member 7
Synonyms: MOR261-6, GA_x6K02T2P3E9-4384160-4383228, Olfr13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18310
Homologene: 27232
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Or1e33
Name: olfactory receptor family 1 subfamily E member 33
Synonyms: GA_x6K02T2P1NL-4004140-4003208, MOR135-7, Olfr393
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259010
Homologene: 79335
Ccdc136
Name: coiled-coil domain containing 136
Synonyms: 4921511K06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232664
Homologene: 23378
Vmn1r189
Name: vomeronasal 1 receptor 189
Synonyms: V1rh2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252906
Homologene: 110880
Scgb2b7
Name: secretoglobin, family 2B, member 7
Synonyms: Gm4684, Abpbg7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043836
Homologene: 83171
Gtsf2
Name: gametocyte specific factor 2
Synonyms: BC048502
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223927
VEGA: 15
Homologene: 77620
Flacc1
Name: flagellum associated containing coiled-coil domains 1
Synonyms: 4933405P16Rik, 4933425F06Rik, Als2cr12
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108812
Homologene: 51399
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
Plekhf1
Name: pleckstrin homology domain containing, family F (with FYVE domain) member 1
Synonyms: 1810013P09Rik, LAPF
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72287
Homologene: 11516
Klk1b8
Name: kallikrein 1-related peptidase b8
Synonyms: TADG14, mGK-8, Klk8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16624
Homologene: 68141
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Gm21680
Name: predicted gene, 21680
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862368
Homologene: 69402
Krtap10-32
Name: keratin associated protein 10-32
Synonyms: Gm18596
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100417409
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,667,723 bp
  • A to G, chromosome 1 at 92,608,716 bp
  • T to C, chromosome 1 at 162,876,829 bp
  • T to G, chromosome 1 at 181,680,756 bp
  • A to T, chromosome 2 at 111,754,762 bp
  • T to A, chromosome 2 at 130,737,380 bp
  • T to C, chromosome 3 at 52,345,282 bp
  • G to T, chromosome 3 at 87,754,583 bp
  • C to T, chromosome 3 at 90,220,813 bp
  • T to C, chromosome 3 at 117,575,883 bp
  • A to T, chromosome 5 at 25,971,349 bp
  • A to G, chromosome 5 at 31,299,559 bp
  • C to T, chromosome 5 at 137,298,808 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • A to G, chromosome 6 at 29,406,110 bp
  • T to C, chromosome 6 at 43,174,735 bp
  • A to T, chromosome 6 at 47,533,779 bp
  • T to A, chromosome 6 at 121,007,364 bp
  • T to A, chromosome 6 at 122,969,369 bp
  • T to G, chromosome 6 at 135,772,341 bp
  • T to A, chromosome 6 at 142,354,711 bp
  • G to A, chromosome 7 at 3,489,203 bp
  • A to C, chromosome 7 at 3,611,748 bp
  • T to C, chromosome 7 at 31,705,177 bp
  • C to A, chromosome 7 at 38,221,574 bp
  • A to G, chromosome 7 at 43,466,596 bp
  • G to A, chromosome 7 at 43,954,782 bp
  • C to T, chromosome 7 at 104,232,448 bp
  • T to G, chromosome 8 at 105,688,498 bp
  • T to C, chromosome 8 at 125,887,920 bp
  • T to G, chromosome 9 at 57,141,172 bp
  • G to A, chromosome 9 at 57,258,522 bp
  • T to C, chromosome 9 at 75,344,954 bp
  • A to G, chromosome 9 at 97,100,073 bp
  • C to A, chromosome 9 at 100,705,245 bp
  • C to T, chromosome 9 at 108,294,509 bp
  • A to T, chromosome 10 at 26,344,186 bp
  • G to A, chromosome 10 at 77,742,328 bp
  • T to C, chromosome 10 at 78,752,424 bp
  • T to A, chromosome 10 at 92,722,396 bp
  • T to A, chromosome 11 at 3,529,477 bp
  • TTTGGCCTCAGCTGGTGACTTGGGCTCAGCTGGAGACTTGGCCTCACCTGGTGACTTG to TTTGGCCTCACCTGGTGACTTG, chromosome 11 at 4,940,530 bp
  • T to A, chromosome 11 at 59,086,869 bp
  • A to T, chromosome 11 at 73,847,580 bp
  • C to T, chromosome 11 at 91,577,197 bp
  • A to G, chromosome 11 at 105,325,508 bp
  • C to T, chromosome 11 at 119,891,210 bp
  • T to C, chromosome 12 at 100,966,417 bp
  • T to C, chromosome 13 at 22,102,641 bp
  • T to C, chromosome 13 at 114,968,519 bp
  • A to T, chromosome 14 at 24,156,479 bp
  • G to A, chromosome 15 at 58,009,917 bp
  • A to T, chromosome 15 at 85,107,072 bp
  • T to C, chromosome 15 at 103,444,356 bp
  • T to G, chromosome 16 at 55,849,634 bp
  • A to G, chromosome 17 at 18,326,238 bp
  • C to T, chromosome 17 at 32,153,818 bp
  • T to C, chromosome 18 at 20,592,478 bp
  • G to A, chromosome 18 at 37,487,319 bp
  • A to T, chromosome 18 at 56,526,988 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8925 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068708-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.