Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8925Btlr/Mmmh
Stock Number:
068708-MU
Citation ID:
RRID:MMRRC_068708-MU
Other Names:
R8925 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Gnb5
Name: guanine nucleotide binding protein (G protein), beta 5
Synonyms: G beta 5, Gbeta5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14697
VEGA: 9
HGNC: HGNC:4401
Homologene: 40714
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,667,723 bp
  • A to G, chromosome 1 at 92,608,716 bp
  • T to C, chromosome 1 at 162,876,829 bp
  • T to G, chromosome 1 at 181,680,756 bp
  • A to T, chromosome 2 at 111,754,762 bp
  • T to A, chromosome 2 at 130,737,380 bp
  • T to C, chromosome 3 at 52,345,282 bp
  • G to T, chromosome 3 at 87,754,583 bp
  • C to T, chromosome 3 at 90,220,813 bp
  • T to C, chromosome 3 at 117,575,883 bp
  • A to T, chromosome 5 at 25,971,349 bp
  • A to G, chromosome 5 at 31,299,559 bp
  • C to T, chromosome 5 at 137,298,808 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • A to G, chromosome 6 at 29,406,110 bp
  • T to C, chromosome 6 at 43,174,735 bp
  • A to T, chromosome 6 at 47,533,779 bp
  • T to A, chromosome 6 at 121,007,364 bp
  • T to A, chromosome 6 at 122,969,369 bp
  • T to G, chromosome 6 at 135,772,341 bp
  • T to A, chromosome 6 at 142,354,711 bp
  • G to A, chromosome 7 at 3,489,203 bp
  • A to C, chromosome 7 at 3,611,748 bp
  • T to C, chromosome 7 at 31,705,177 bp
  • C to A, chromosome 7 at 38,221,574 bp
  • A to G, chromosome 7 at 43,466,596 bp
  • G to A, chromosome 7 at 43,954,782 bp
  • C to T, chromosome 7 at 104,232,448 bp
  • T to G, chromosome 8 at 105,688,498 bp
  • T to C, chromosome 8 at 125,887,920 bp
  • T to G, chromosome 9 at 57,141,172 bp
  • G to A, chromosome 9 at 57,258,522 bp
  • T to C, chromosome 9 at 75,344,954 bp
  • A to G, chromosome 9 at 97,100,073 bp
  • C to A, chromosome 9 at 100,705,245 bp
  • C to T, chromosome 9 at 108,294,509 bp
  • A to T, chromosome 10 at 26,344,186 bp
  • G to A, chromosome 10 at 77,742,328 bp
  • T to C, chromosome 10 at 78,752,424 bp
  • T to A, chromosome 10 at 92,722,396 bp
  • T to A, chromosome 11 at 3,529,477 bp
  • TTTGGCCTCAGCTGGTGACTTGGGCTCAGCTGGAGACTTGGCCTCACCTGGTGACTTG to TTTGGCCTCACCTGGTGACTTG, chromosome 11 at 4,940,530 bp
  • T to A, chromosome 11 at 59,086,869 bp
  • A to T, chromosome 11 at 73,847,580 bp
  • C to T, chromosome 11 at 91,577,197 bp
  • A to G, chromosome 11 at 105,325,508 bp
  • C to T, chromosome 11 at 119,891,210 bp
  • T to C, chromosome 12 at 100,966,417 bp
  • T to C, chromosome 13 at 22,102,641 bp
  • T to C, chromosome 13 at 114,968,519 bp
  • A to T, chromosome 14 at 24,156,479 bp
  • G to A, chromosome 15 at 58,009,917 bp
  • A to T, chromosome 15 at 85,107,072 bp
  • T to C, chromosome 15 at 103,444,356 bp
  • T to G, chromosome 16 at 55,849,634 bp
  • A to G, chromosome 17 at 18,326,238 bp
  • C to T, chromosome 17 at 32,153,818 bp
  • T to C, chromosome 18 at 20,592,478 bp
  • G to A, chromosome 18 at 37,487,319 bp
  • A to T, chromosome 18 at 56,526,988 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8925 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068708-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.