MMRRC:040145-MU

T to A, chromosome 1 at 20,523,895 bp
G to T, chromosome 1 at 25,068,209 bp
T to A, chromosome 1 at 46,268,670 bp
G to A, chromosome 1 at 75,486,756 bp
T to C, chromosome 1 at 111,859,457 bp
C to T, chromosome 1 at 130,449,423 bp
C to G, chromosome 1 at 133,350,778 bp
A to T, chromosome 1 at 133,903,796 bp
C to T, chromosome 1 at 133,915,131 bp
ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
AG to AGG, chromosome 1 at 134,971,364 bp
ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
TCC to TCCGCC, chromosome 1 at 135,386,275 bp
CCT to CCTTCT, chromosome 1 at 135,386,282 bp
A to G, chromosome 1 at 135,402,250 bp
TG to TGG, chromosome 1 at 135,846,761 bp
AGGG to AGG, chromosome 1 at 135,974,852 bp
CC to CCGAC, chromosome 1 at 136,490,395 bp
GCGGCAGCTCCGGCAGC to GCGGCAGCTCCGGCAGCTCCGGCAGC, chromosome 1 at 136,625,353 bp
T to G, chromosome 1 at 139,831,155 bp
T to C, chromosome 1 at 143,760,034 bp
T to A, chromosome 2 at 30,336,706 bp
CAGAG to CAG, chromosome 2 at 35,122,806 bp
C to T, chromosome 2 at 76,813,339 bp
T to C, chromosome 2 at 85,508,337 bp
C to T, chromosome 2 at 85,759,677 bp
C to T, chromosome 2 at 89,439,583 bp
T to C, chromosome 2 at 103,731,303 bp
T to A, chromosome 2 at 109,333,503 bp
C to A, chromosome 2 at 111,645,221 bp
T to G, chromosome 2 at 125,412,708 bp
G to A, chromosome 2 at 135,976,099 bp
T to C, chromosome 2 at 181,231,380 bp
A to G, chromosome 3 at 51,256,440 bp
A to G, chromosome 3 at 84,594,363 bp
G to T, chromosome 3 at 89,219,376 bp
C to T, chromosome 3 at 93,826,899 bp
G to A, chromosome 3 at 94,389,526 bp
A to G, chromosome 3 at 130,570,316 bp
C to T, chromosome 4 at 41,379,257 bp
C to T, chromosome 4 at 123,355,102 bp
A to G, chromosome 4 at 134,229,628 bp
C to T, chromosome 4 at 139,477,207 bp
A to G, chromosome 4 at 148,024,137 bp
A to T, chromosome 5 at 8,987,780 bp
A to G, chromosome 5 at 31,247,929 bp
T to C, chromosome 5 at 75,968,423 bp
T to C, chromosome 5 at 88,772,723 bp
T to C, chromosome 5 at 113,764,093 bp
C to T, chromosome 5 at 114,125,716 bp
G to A, chromosome 5 at 135,217,275 bp
T to C, chromosome 6 at 25,750,044 bp
T to A, chromosome 6 at 34,417,269 bp
T to A, chromosome 6 at 38,082,936 bp
A to T, chromosome 6 at 72,587,605 bp
T to A, chromosome 6 at 83,986,596 bp
T to C, chromosome 6 at 85,337,228 bp
A to T, chromosome 6 at 121,031,134 bp
T to A, chromosome 6 at 132,207,203 bp
T to C, chromosome 6 at 132,737,358 bp
A to G, chromosome 6 at 133,529,275 bp
T to C, chromosome 7 at 12,479,726 bp
A to G, chromosome 7 at 27,219,650 bp
T to C, chromosome 7 at 29,531,510 bp
T to C, chromosome 7 at 44,733,077 bp
C to A, chromosome 7 at 55,997,511 bp
A to T, chromosome 7 at 65,658,897 bp
C to T, chromosome 7 at 104,050,300 bp
T to A, chromosome 7 at 106,329,956 bp
G to A, chromosome 7 at 127,582,214 bp
A to T, chromosome 7 at 131,555,859 bp
A to G, chromosome 7 at 135,695,592 bp
T to C, chromosome 8 at 18,714,140 bp
T to A, chromosome 8 at 93,130,840 bp
C to A, chromosome 8 at 99,111,693 bp
G to C, chromosome 9 at 37,666,673 bp
G to A, chromosome 9 at 44,681,141 bp
T to A, chromosome 9 at 63,616,675 bp
C to T, chromosome 9 at 107,658,762 bp
A to G, chromosome 10 at 13,505,865 bp
A to G, chromosome 10 at 27,616,690 bp
T to C, chromosome 10 at 53,934,998 bp
A to G, chromosome 10 at 89,812,048 bp
G to A, chromosome 10 at 121,392,778 bp
A to G, chromosome 10 at 129,437,747 bp
A to G, chromosome 11 at 30,820,998 bp
G to T, chromosome 11 at 49,170,626 bp
A to G, chromosome 11 at 49,523,839 bp
A to G, chromosome 11 at 67,189,332 bp
CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
C to T, chromosome 11 at 69,991,689 bp
G to C, chromosome 11 at 76,211,050 bp
G to A, chromosome 11 at 78,540,034 bp
A to G, chromosome 11 at 108,606,325 bp
T to C, chromosome 11 at 116,977,670 bp
T to C, chromosome 12 at 104,008,309 bp
C to T, chromosome 12 at 111,485,181 bp
T to A, chromosome 13 at 44,906,276 bp
T to C, chromosome 13 at 55,454,364 bp
G to T, chromosome 13 at 67,708,192 bp
T to A, chromosome 13 at 116,894,886 bp
A to G, chromosome 14 at 33,945,241 bp
A to G, chromosome 14 at 54,990,910 bp
T to G, chromosome 14 at 110,750,794 bp
C to A, chromosome 15 at 12,406,559 bp
A to G, chromosome 15 at 25,714,108 bp
G to T, chromosome 15 at 34,238,332 bp
T to C, chromosome 15 at 76,183,174 bp
T to C, chromosome 15 at 79,130,795 bp
T to A, chromosome 15 at 82,022,977 bp
T to A, chromosome 16 at 20,551,637 bp
G to A, chromosome 16 at 97,538,703 bp
A to G, chromosome 17 at 13,810,433 bp
T to A, chromosome 17 at 18,253,372 bp
T to G, chromosome 17 at 37,610,471 bp
T to C, chromosome 17 at 40,911,084 bp
C to T, chromosome 17 at 42,666,898 bp
A to G, chromosome 18 at 10,574,873 bp
A to G, chromosome 18 at 31,153,713 bp
A to G, chromosome 18 at 37,422,123 bp
A to G, chromosome 18 at 40,259,178 bp
A to T, chromosome 18 at 80,969,831 bp
T to A, chromosome 19 at 5,605,685 bp
T to A, chromosome 19 at 6,106,811 bp
T to C, chromosome 19 at 8,845,320 bp
T to C, chromosome 19 at 10,619,126 bp
T to A, chromosome X at 23,907,310 bp
A to G, chromosome X at 99,147,517 bp
G to A, chromosome X at 135,802,042 bp
G to T, chromosome X at 151,862,641 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R2142 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
040145-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All