Strain Name:
C57BL/6J-MtgxR4380Btlr/Mmmh
Stock Number:
041678-MU
Citation ID:
RRID:MMRRC_041678-MU
Other Names:
R4380 (G1), C57BL/6J-MtgxR4380Btlr
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Pde1c
Name: phosphodiesterase 1C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18575
HGNC: HGNC:8776
Homologene: 3682
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Snx4
Name: sorting nexin 4
Synonyms: 1810036H14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69150
VEGA: 16
Homologene: 36143
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Nme7
Name: NME/NM23 family member 7
Synonyms: Nm23-M7, nucleoside-diphosphate kinase, D530024H21Rik, non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171567
Homologene: 8344
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Casc3
Name: exon junction complex subunit
Synonyms: Btz, Mln51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192160
Homologene: 7208
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Lrp10
Name: low-density lipoprotein receptor-related protein 10
Synonyms: Lrp9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65107
VEGA: 14
Homologene: 8535
Dync1li2
Name: dynein, cytoplasmic 1 light intermediate chain 2
Synonyms: LIC2, Dncli2, Dnclic2, Dlic2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234663
HGNC: HGNC:2966
Homologene: 4474
Gmds
Name: GDP-mannose 4, 6-dehydratase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218138
HGNC: HGNC:4369
Homologene: 75968
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: ZNFPR1B1, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Jbo, Evi1, Mds1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD153, CD30LG
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21949
Homologene: 950
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244484
Homologene: 12460
Gm17067
Name: predicted gene 17067
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 115486519
2310016G11Rik
Name: RIKEN cDNA 2310016G11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69578
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268780
Homologene: 65044
Cep162
Name: centrosomal protein 162
Synonyms: 4922501C03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382090
Homologene: 8930
Clk3
Name: CDC-like kinase 3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102414
VEGA: 9
HGNC: HGNC:2071
Homologene: 101534
L3mbtl1
Name: L3MBTL1 histone methyl-lysine binding protein
Synonyms: L3MBTL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241764
Homologene: 41846
Slc34a2
Name: solute carrier family 34 (sodium phosphate), member 2
Synonyms: type IIb Na/Picotransporter, Npt2b, NaPi-2b, D5Ertd227e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20531
Homologene: 2297
Pramel23
Name: PRAME like 23
Synonyms: Gm13089
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277667
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Sp6
Name: trans-acting transcription factor 6
Synonyms: Klf14, 1110025J03Rik, epiprofin, Epfn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83395
Homologene: 19879
Stat5b
Name: signal transducer and activator of transcription 5B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20851
Homologene: 55718
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Or4s2b
Name: olfactory receptor family 4 subfamily S member 2B
Synonyms: GA_x6K02T2Q125-50158288-50158818, GA_x6K02T2Q125-50154044-50154826, MOR230-9, MOR226-1, Olfr1194-ps1, Olfr1193
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329460
Homologene: 27297
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22238
Homologene: 137225
Plppr4
Name: phospholipid phosphatase related 4
Synonyms: D3Bwg0562e, Lppr4, PRG-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229791
Homologene: 8895
Zfp28
Name: zinc finger protein 28
Synonyms: mkr-5, Zfp-28, 2810438M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22690
Homologene: 69047
Or5ac15
Name: olfactory receptor family 5 subfamily AC member 15
Synonyms: GA_x54KRFPKG5P-55348161-55347241, MOR182-7P, MOR182-13, Olfr194
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 433031
Homologene: 122781
Slco5a1
Name: solute carrier organic anion transporter family, member 5A1
Synonyms: A630033C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240726
Homologene: 57135
Rpl31-ps20
Name: ribosomal protein L31, pseudogene 20
Synonyms: Gm6635
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 625917
Mcfd2
Name: multiple coagulation factor deficiency 2
Synonyms: 1810021C21Rik, LMAN1IP, F5F8D
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193813
Homologene: 44552
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 12,939,168 bp
  • T to C, chromosome 1 at 34,163,235 bp
  • T to C, chromosome 1 at 135,967,771 bp
  • A to G, chromosome 1 at 164,345,238 bp
  • A to T, chromosome 1 at 193,331,375 bp
  • A to T, chromosome 2 at 76,918,141 bp
  • A to G, chromosome 2 at 88,678,271 bp
  • C to A, chromosome 2 at 162,966,593 bp
  • T to C, chromosome 3 at 29,987,070 bp
  • T to G, chromosome 3 at 117,322,397 bp
  • A to T, chromosome 3 at 142,830,456 bp
  • A to T, chromosome 4 at 63,861,027 bp
  • ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT, chromosome 4 at 72,118,163 bp
  • A to G, chromosome 4 at 123,354,492 bp
  • T to A, chromosome 4 at 143,698,286 bp
  • C to T, chromosome 5 at 53,069,286 bp
  • T to C, chromosome 5 at 64,333,548 bp
  • T to A, chromosome 5 at 87,127,894 bp
  • T to A, chromosome 6 at 56,072,278 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • C to T, chromosome 7 at 6,393,442 bp
  • C to A, chromosome 7 at 42,708,038 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 44,677,156 bp
  • T to C, chromosome 8 at 54,648,407 bp
  • A to T, chromosome 8 at 104,428,166 bp
  • A to G, chromosome 8 at 108,956,390 bp
  • C to A, chromosome 9 at 57,751,792 bp
  • C to A, chromosome 9 at 87,200,003 bp
  • T to C, chromosome 11 at 97,021,746 bp
  • C to A, chromosome 11 at 98,823,031 bp
  • A to G, chromosome 11 at 100,787,349 bp
  • T to A, chromosome 13 at 31,917,696 bp
  • C to T, chromosome 14 at 54,468,366 bp
  • A to T, chromosome 15 at 7,243,869 bp
  • T to A, chromosome 15 at 86,351,734 bp
  • T to A, chromosome 16 at 33,264,296 bp
  • C to T, chromosome 16 at 59,119,664 bp
  • G to A, chromosome 16 at 93,716,232 bp
  • C to G, chromosome 17 at 87,257,959 bp
  • G to T, chromosome 19 at 30,160,768 bp
  • G to C, chromosome 19 at 41,053,233 bp
  • G to A, chromosome 19 at 47,657,090 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4380 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041678-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.